A Review of Control Schemes for Active Power Filters in Order to Power Quality Improvement

Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.

Detection ofTensile Forces in Cable-Stayed Structures Using the Advanced Hybrid Micro-Genetic Algorithm

This study deals with an advanced numerical techniques to detect tensile forces in cable-stayed structures. The proposed method allows us not only to avoid the trap of minimum at initial searching stage but also to find their final solutions in better numerical efficiency. The validity of the technique is numerically verified using a set of dynamic data obtained from a simulation of the cable model modeled using the finite element method. The results indicate that the proposed method is computationally efficient in characterizing the tensile force variation for cable-stayed structures.

Ways of Life of Undergraduate Students Based On Sufficiency Economy Philosophy in Suan Sunandha Rajabhat University

This study aimed to analyse the application of sufficiency economy in students’ ways of life on campus at Suan Sunandha Rajabhat University. Data was gathered through 394 questionnaires. The study results found that the majority of students were confident that “where there’s a will, there’s a way.” Overall, the students applied the sufficiency economy at a great level, along with being persons who do not exploit others, were satisfied with living their lives moderately, according to the sufficiency economy. Importance was also given to kindness and generosity. Importantly, students were happy with living according to their individual circumstances and status at the present. They saw the importance of joint life planning, self-development, and self-dependence, always learning to be satisfied with “adequate”. As for their practices and ways of life, socially relational activities rated highly, especially initiation activities for underclassmen at the university and the seniority system, which are suitable for activities on campus. Furthermore, the students knew how to build a career and find supplemental income, knew how to earnestly work according to convention to finish work, and preferred to study elective subjects which directly benefit career-wise. The students’ application of sufficiency economy philosophy principles depended on their lives in their hometowns. The students from the provinces regularly applied sufficiency economy philosophy to their lives, for example, by being frugal, steadfast, determined, avoiding negligence, and making economical spending plans; more so than the students from the capital.

Case Study: Linking Career Education to University Education in Japan

Japanese society is experiencing an aging population and declining birth rate along with the popularization of higher education, spread of economic globalization, rapid progress in technical innovation, changes in employment conditions, and emergence of a knowledge-based society. Against this background, interest in career education at Japanese universities has increased in recent years. This paper describes how the government has implemented career education policies in Japan, and introduces the cases of two universities that have successfully linked career education to university education in Japan.

Sustainability as a Criterion in the Reconstruction of Libya’s Public Transport Infrastructure

Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

The Development of Speaking Using Folk Tales Based On Performance Activities for Early Childhood Student

The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.

Farmers’ Awareness and Behavior of Chemical Pesticide Uses in Suan Luang Sub-District Municipality, Ampawa, Samut Songkram, Thailand

This paper is aimed to investigate farmers’ level of awareness and behavior of chemical pesticide uses, by using a case study of Suan Luang Sub- District Municipality, Ampawa, Samut Songkram Province. Questionnaire was employed in this study with the farmers from 46 households to explore their level of awareness in chemical pesticide uses, while interview and observation were adopted in exploring their behavior of chemical pesticide uses. The findings reflected the farmers’ high level of awareness in chemical pesticide uses in the hazardous effects of the chemical to human and environmental health, while their behavior of chemical pesticide uses explained their awareness paid to the right way of using pesticides, for instance reading the direction on the label, keeping children and animals away from the area of pesticide mixing, covering body with clothes and wearing hat and mask, no smoking, eating or drinking during pesticide spray or standing in windward direction.

Operating Live E! Digital Meteorological Equipments Using Solar Photovoltaics

We installed solar panels and digital meteorological equipments whose electrical power is supplied using PV on July 13, 2011. Then, the relationship between the electric power generation and the irradiation, air temperature, and wind velocity was investigated on a roof at a university. The electrical power generation, irradiation, air temperature, and wind velocity were monitored over two years. By analyzing the measured meteorological data and electric power generation data using PTC, we calculated the size of the solar panel that is most suitable for this system. We also calculated the wasted power generation using PTC with the measured meteorological data obtained in this study. In conclusion, to reduce the "wasted power generation", a smaller-size solar panel is required for stable operation.

Design and Implementation of a Control System for a Walking Robot with Color Sensing and Line Following Using PIC and ATMEL Microcontrollers

The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.

Fuzzy C-Means Clustering for Biomedical Documents Using Ontology Based Indexing and Semantic Annotation

Search is the most obvious application of information retrieval. The variety of widely obtainable biomedical data is enormous and is expanding fast. This expansion makes the existing techniques are not enough to extract the most interesting patterns from the collection as per the user requirement. Recent researches are concentrating more on semantic based searching than the traditional term based searches. Algorithms for semantic searches are implemented based on the relations exist between the words of the documents. Ontologies are used as domain knowledge for identifying the semantic relations as well as to structure the data for effective information retrieval. Annotation of data with concepts of ontology is one of the wide-ranging practices for clustering the documents. In this paper, indexing based on concept and annotation are proposed for clustering the biomedical documents. Fuzzy c-means (FCM) clustering algorithm is used to cluster the documents. The performances of the proposed methods are analyzed with traditional term based clustering for PubMed articles in five different diseases communities. The experimental results show that the proposed methods outperform the term based fuzzy clustering.

Determination the Curve Number Catchment by Using GIS and Remote Sensing

In recent years, geographic information systems (GIS) and remote sensing using has increased to estimate runoff catchment. In this research, runoff curve number maps for captive catchment of Tehran by helping GIS and also remote sensing which based on factors such as vegetation, lands using, group of soil hydrology and hydrological conditions were obtained. Runoff curve numbers map was obtained by combining these maps in ARC GIS and SCS table. To evaluate the accuracy of the results, the maximum flow rate of flood which was obtained from curve numbers, was compared with the measured maximum flood rate at the watershed outlet and correctness of curve numbers were approved.

Effect of 2wt% Cu Addition on the Tensile Properties and Fracture Behavior of Peak Aged Al-6Si-0.5Mg-2Ni Alloy at Various Strain Rates

Effect of 2wt% Cu addition on tensile properties and fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys, were aged isochronally for 1 hour at temperatures up to 300oC. The uniaxial tension test was carried out at strain rate ranging from 10-4s-1 to 10-2s-1 in order to investigate the strain rate dependence of tensile properties. Tensile strengths were found to increase with ageing temperature and the maximum being attained ageing for 1 hr at 225oC (peak aged condition). Addition of 2wt% Cu resulted in an increase in tensile properties at all strain rates. Evaluation of tensile properties at three different strain rates (10-4, 10-3 and 10-2 s-1) showed that strain rates affected the tensile properties significantly. At higher strain rates the strength was better but ductility was poor. Microstructures of broken specimens showed that both the void coalescence and the interface debonding affect the fracture behavior of the alloys

Enhancement of Heat Transfer Rate in a Solar Flat Plate Collector Using Twisted Tapes and Wire Coiled Turbulators

Effects of insertion of coiled wire in juxtaposition with twisted tapes on heat transfer rate and solar radiation without disturbing the flow inside the riser tubes in a solar flat plate collector is experimentally reconnoitered in this present work. The wire coil used as a turbulator is placed inside the riser tube while the twisted tape is inserted into the wire coil to create a continuous swirling flow along the tube wall. The results of the heat transfer have been compared well with the available results. The heat transfer rate in the collector has been found to be increased by 18% to 70%. Solar water heaters having inserts in the flow tubes perform better than the conventional plain ones. It has been observed that heat losses are reduced consequently increasing the thermal performance about 30% over the plain water heaters under the same operating conditions. The effect of twisted tape with wire coils, flow Reynolds number, and the intensity of solar radiation on the thermal performance of the solar water heater has been presented. Effects of insertion of coiled wire in juxtaposition with twisted tapes on heat transfer rate and solar radiation without disturbing the flow inside the riser tubes in a solar flat plate collector is experimentally reconnoitered in this present work. The wire coil used as a turbulator is placed inside the riser tube while the twisted tape is inserted into the wire coil to create a continuous swirling flow along the tube wall. The results of the heat transfer have been compared well with the available results. The heat transfer rate in the collector has been found to be increased by 18% to 70%. Solar water heaters having inserts in the flow tubes perform better than the conventional plain ones. It has been observed that heat losses are reduced consequently increasing the thermal performance about 30% over the plain water heaters under the same operating conditions. The effect of twisted tape with wire coils, flow Reynolds number, and the intensity of solar radiation on the thermal performance of the solar water heater has been presented.

Tribological Investigation and the Effect of Karanja Biodiesel on Engine Wear in Compression Ignition Engine

Various biomass based resources, which can be used as an extender, or a complete substitute of diesel fuel may have very significant role in the development of agriculture, industrial and transport sectors in the energy crisis. Use of Karanja oil methyl ester biodiesel in a CI DI engine was found highly compatible with engine performance along with lower exhaust emission as compared to diesel fuel but with slightly higher NOx emission and low wear characteristics. The combustion related properties of vegetable oils are somewhat similar to diesel oil. Neat vegetable oils or their blends with diesel, however, pose various long-term problems in compression ignition engines. These undesirable features of vegetable oils are because of their inherent properties like high viscosity, low volatility, and polyunsaturated character. Pongamia methyl ester (PME) was prepared by transesterification process using methanol for long term engine operations. The physical and combustion-related properties of the fuels thus developed were found to be closer to that of the diesel. A neat biodiesel (PME) was selected as a fuel for the tribological study of biofuels. Two similar new engines were completely disassembled and subjected to dimensioning of various vital moving parts and then subjected to long-term endurance tests on neat biodiesel and diesel respectively. After completion of the test, both the engines were again disassembled for physical inspection and wear measurement of various vital parts. The lubricating oil samples drawn from both engines were subjected to atomic absorption spectroscopy (AAS) for measurement of various wear metal traces present. The additional lubricating property of biodiesel fuel due to higher viscosity as compared to diesel fuel resulted in lower wear of moving parts and thus improved the engine durability with a bio-diesel fuel. Results reported from AAS tests confirmed substantially lower wear and thus improved life for biodiesel operated engines.

Physical and Thermo-Physical Properties of High Strength Concrete Containing Raw Rice Husk after High Temperature Effect

High temperature is one of the most detrimental effects that cause important changes in concrete’s mechanical, physical, and thermo-physical properties. As a result of these changes, especially high strength concrete (HSC), may exhibit damages such as cracks and spallings. To overcome this problem, incorporating polymer fibers such as polypropylene (PP) in concrete is a very well-known method. In this study, using RRH, as a sustainable material, instead of PP fiber in HSC to prevent spallings and improve physical and thermo-physical properties were investigated. Therefore, seven HSC mixtures with 0.25 water to binder ratio were prepared incorporating silica fume and blast furnace slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of cement, respectively. All specimens were subjected to high temperatures (20 (control), 300, 600 and 900˚C) with a heating rate of 2.5˚C/min and after cooling, residual physical and thermo-physical properties were determined.

Low Power CNFET SRAM Design

CNFET has emerged as an alternative material to silicon for high performance, high stability and low power SRAM design in recent years. SRAM functions as cache memory in computers and many portable devices. In this paper, a new SRAM cell design based on CNFET technology is proposed. The proposed SRAM cell design for CNFET is compared with SRAM cell designs implemented with the conventional CMOS and FinFET in terms of speed, power consumption, stability, and leakage current. The HSPICE simulation and analysis show that the dynamic power consumption of the proposed 8T CNFET SRAM cell’s is reduced about 48% and the SNM is widened up to 56% compared to the conventional CMOS SRAM structure at the expense of 2% leakage power and 3% write delay increase.

A Comparison of Double Sided Friction Stir Welding in Air and Underwater for 6mm S275 Steel Plate

This study compared the mechanical and microstructural properties produced during friction stir welding (FSW) of S275 structural steel in air and underwater. Post weld tests assessed the tensile strength, micro-hardness, distortion, Charpy impact toughness and fatigue performance in each case. The study showed that there was no significant difference in the strength, hardness or fatigue life of the air and underwater specimens. However, Charpy impact toughness was shown to decrease for the underwater specimens and was attributed to a lower degree of recrystallization caused by the higher rate of heat loss experienced when welding underwater. Reduced angular and longitudinal distortion was observed in the underwater welded plate compared to the plate welded in air.

Graphene Based Electronic Device

The semiconductor industry is placing an increased emphasis on emerging materials and devices that may provide improved performance, or provide novel functionality for devices. Recently, graphene, as a true two-dimensional carbon material, has shown fascinating applications in electronics. In this paper detailed discussions are introduced for possible applications of grapheme Transistor in RF and digital devices.

Models of Copyrights System

The copyrights system is a combination of different elements. The number, content and the correlation of these elements are different for different legal orders. The models of copyrights systems display this system in terms of the interaction of economic and author's moral rights. Monistic and dualistic models are the most popular ones. The article deals with different points of view on the monism and dualism in copyright system. A specific model of the copyright in Switzerland in the XXth century is analyzed. The evolution of a French dualistic model of copyright is shown. The author believes that one should talk not about one, but rather about a number of dualism forms of copyright system.