Abstract: The scope of this paper is to evaluate and compare the potential of LS-PV(Large Scale Photovoltaic Power Plant) power generation systems in the southern region of Libya at Al-Kufra for both stationary and tracking systems. A Microsoft Excel-VBA program has been developed to compute slope radiation, dew-point, sky temperature, and then cell temperature, maximum power output and module efficiency of the system for stationary system and for tracking system. The results for energy production show that the total energy output is 114GWh/year for stationary system and 148GWh/year for tracking system. The average module efficiency for the stationary system is 16.6% and 16.2% for the tracking system.
The values of electricity generation capacity factor (CF) and solar capacity factor (SCF) for stationary system were found to be 26% and 62.5% respectively and 34% and 82% for tracking system. The GCR (Ground Cover Ratio) for a stationary system is 0.7, which corresponds to a tilt angle of 24°. The GCR for tracking system was found to be 0.12. The estimated ground area needed to build a 50MW PV plant amounts to approx. 0.55km2 for a stationary PV field constituted by HIT PV arrays and approx. 91MW/ km2. In case of a tracker PV field, the required ground area amounts approx.2.4km2 and approx. 20.5MW/ km2.
Abstract: In this paper, the comparison between k-Nearest Neighbor (kNN) algorithms for classifying the 3D EEG model in brain balancing is presented. The EEG signal recording was conducted on 51 healthy subjects. Development of 3D EEG models involves pre-processing of raw EEG signals and construction of spectrogram images. Then, maximum PSD values were extracted as features from the model. There are three indexes for balanced brain; index 3, index 4 and index 5. There are significant different of the EEG signals due to the brain balancing index (BBI). Alpha-α (8–13 Hz) and beta-β (13–30 Hz) were used as input signals for the classification model. The k-NN classification result is 88.46% accuracy. These results proved that k-NN can be used in order to predict the brain balancing application.
Abstract: The extracellular proteins secreted by bacteria may be increased in stressful surroundings, such as in the presence of antibiotics. It appears that many antibiotics, when used at low concentrations, have in common the ability to activate or repress gene transcription, which is distinct from their inhibitory effect. There have been comparatively few studies on the potential of antibiotics as a specific chemical signal that can trigger a variety of biological functions. Therefore, this study was carried out to determine the effect of Streptomycin Sulfate in regulating extracellular proteins secreted by Bacillus subtilis ATCC21332. Results of Microdilution assay showed that the Minimum Inhibition Concentration (MIC) of Streptomycin Sulfate on B. subtilis ATCC21332 was 2.5 mg/ml. The bacteria cells were then exposed to Streptomycin Sulfate at concentration of 0.01 MIC before being further incubated for 48h to 72 h. The extracellular proteins secreted were then isolated and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins profile revealed that three additional bands with approximate sizes of 30 kDa, 22 kDa and 23 kDa were appeared for the treated bacteria with Streptomycin Sulfate. Thus, B. subtilis ATCC21332 in stressful condition with the presence of Streptomycin Sulfate at low concentration could induce the extracellular proteins secretion.
Abstract: Ferulic acid has widespread industrial potential by virtue of its antioxidant properties. However, it is partially soluble in aqueous media, limiting their usefulness in oil-based processes in food, cosmetic, pharmaceutical, and material industry. Therefore, modification of ferulic acid should be made by producing of more lipophilic derivatives. In this study, a preliminary investigation of lipase-catalyzed trans-esterification reaction of ethyl ferulate and olive oil was investigated. The reaction was catalyzed by immobilized lipase from Candida antarctica (Novozym 435), to produce ferulate ester, a sunscreen agent. A statistical approach of Response surface methodology (RSM) was used to evaluate the interactive effects of reaction temperature (40-80°C), reaction time (4-12 hours), and amount of enzyme (0.1-0.5 g). The optimum conditions derived via RSM were reaction temperature 60°C, reaction time 2.34 hours, and amount of enzyme 0.3 g. The actual experimental yield was 59.6% ferulate ester under optimum condition, which compared well to the maximum predicted value of 58.0%.
Abstract: Except for the internal aspects of entrepreneurship (i.e.motivation, opportunity perspective and alertness), there are external aspects that affecting entrepreneurship (i.e. the industrial cluster). By comparing the machinery companies located inside and outside the industrial district, this study aims to explore the cluster effects on the entrepreneurship of companies in Taiwan machinery clusters (TMC). In this study, three factors affecting the entrepreneurship in TMC are conducted as “competition”, “embedded-ness” and “specialized knowledge”. The “competition” in the industrial cluster is defined as the competitive advantages that companies gain in form of demand effects and diversified strategies; the “embedded-ness” refers to the quality of company relations (relational embedded-ness) and ranges (structural embedded-ness) with the industry components (universities, customers and complementary) that affecting knowledge transfer and knowledge generations; the “specialized knowledge” shares theinternal knowledge within industrial clusters. This study finds that when comparing to the companieswhich are outside the cluster, the industrial cluster has positive influence on the entrepreneurship. Additionally, the factor of “relational embedded-ness” has significant impact on the entrepreneurship and affects the adaptation ability of companies in TMC. Finally, the factor of “competition” reveals partial influence on the entrepreneurship.
Abstract: PAN nanofibers reinforced with amine functionalized
carbon nanotubes. The effect of amine functionalization and the
effect of concentration of CNT on the conductivity and mechanical
and morphological properties of composite nanofibers were
examined. 1%CNT-NH2 loaded PAN/CNT nanofiber showed the best
mechanical properties. Conductivity increased with the incorporation
of carbon nanotubes. While an increase of concentration of CNT
increases the diameter of nanofiber, the use of functionalized CNT
results to decrease of diameter of nanofiber.
Abstract: Water is a fundamental attraction in all cultures and among all classes of people,tourists and citizens. It is a favorite location for major tourism initiatives, celebrations and ceremonies. The vitality of any city depends on citizen action to take part in creating the neighborhoods they desire. Waterfront can provide extensive new areas of high quality public open space in parts of the city that are popular venues for social activities and also have the highest land values. Each city must have a character that can be used as a key attraction for the development. The morphology of a waterfront can be identified by both its physical characteristics and the socio-cultural activities that take place in the area. Alexandria has been selected as an area of study because it has a unique character due to its possession of a variety of waterfronts.
This paper aims to set some criteria of successful waterfront development and then through these criteria analyzing the development of the Qaitbay waterfront in the eastern harbor in Alexandria, Egypt. Hence, a comprehensive improvement of the waterfront areas is certainly needed to ensure a successful waterfront development radiated the sense of uniformity and coherence.
Alexandria can benefit from these criteria to develop its urban waterfront in order to preserve and revitalize its unique waterfront character and achieve mixed uses and tourism development.
Abstract: Polymer composite nano-fibers including (1, 3 wt %)
silver nano-particles have been produced by electrospinning method.
Polyacrylonitrile/N,N-dimethylformamide (PAN/DMF) solution have
been prepared and the amount of silver nitrate have been adjusted to
PAN weight. Silver nano-particles were obtained from reduction of
silver ions into silver nano-particles by chemical reduction by
hydrazine hydroxide (N2H5OH). The different amount of silver salt
was loaded into polymer matrix to obtain polyacrylonitrile composite
nano-fiber containing silver nano-particles. The effect of the amount
of silver nano-particles on the properties of composite nano-fiber web
was investigated. Electrical conductivity, mechanical properties,
thermal properties were examined by Microtest LCR Meter 6370
(0.01 mΩ-100 MΩ), Tensile tester, Differential scanning calorimeter
DSC (Q10) and SEM respectively. Also antimicrobial efficiency test
(ASTM E2149-10) was done against to Staphylococcus aureus
bacteria. It has been seen that breaking strength, conductivity,
antimicrobial effect, enthalpy during cyclization increase by use of
silver nano-particles while the diameter of nano-fiber decreases.
Abstract: Banana pseudo-stem and fruit-bunch-stem are
agricultural residues that can be used for conversion to bio-char, biooil,
and gases by using thermochemical process. The aim of this work
is to characterize banana pseudo-stem and banana fruit-bunch-stem
through proximate analysis, elemental analysis, chemical analysis,
thermo-gravimetric analysis, and heating calorific value. The ash
contents of the banana pseudo-stem and banana fruit-bunch-stem are
11.0 mf wt.% and 20.6 mf wt.%; while the carbon content of banana
pseudo-stem and fruit-bunch-stem are 37.9 mf wt.% and 35.58 mf
wt.% respectively. The molecular formulas for banana stem and
banana fruit-bunch-stem are C24H33NO26 and C19H29NO33
respectively. The measured higher heating values of banana pseudostem
and banana fruit-bunch-stem are 15.5MJ/kg and 12.7 MJ/kg
respectively. By chemical analysis, the lignin, cellulose, and
hemicellulose contents in the samples will also be presented. The
feasibility of the banana wastes to be a feedstock for thermochemical
process in comparison with other biomass will be discussed in this
paper.
Abstract: This work presents a comparison study between the state-space and polynomial methods for the design of the robust governor for load frequency control of steam turbine power systems. The robust governor is synthesized using the two approaches and the comparison is extended to include time and frequency domains performance, controller order, and uncertainty representation, weighting filters, optimality and sub-optimality. The obtained results are represented through tables and curves with reasons of similarities and dissimilarities.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: Two new algorithms for nonparametric estimation of errors-in-variables models are proposed. The first algorithm is based on penalized regression spline. The spline is represented as a piecewise-linear function and for each linear portion orthogonal regression is estimated. This algorithm is iterative. The second algorithm involves locally weighted regression estimation. When the independent variable is measured with error such estimation is a complex nonlinear optimization problem. The simulation results have shown the advantage of the second algorithm under the assumption that true smoothing parameters values are known. Nevertheless the use of some indexes of fit to smoothing parameters selection gives the similar results and has an oversmoothing effect.
Abstract: There have been a lot of efforts and researches undertaken in developing efficient tools for performing several tasks in data mining. Due to the massive amount of information embedded in huge data warehouses maintained in several domains, the extraction of meaningful pattern is no longer feasible. This issue turns to be more obligatory for developing several tools in data mining. Furthermore the major aspire of data mining software is to build a resourceful predictive or descriptive model for handling large amount of information more efficiently and user friendly. Data mining mainly contracts with excessive collection of data that inflicts huge rigorous computational constraints. These out coming challenges lead to the emergence of powerful data mining technologies. In this survey a diverse collection of data mining tools are exemplified and also contrasted with the salient features and performance behavior of each tool.
Abstract: Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.
Abstract: Although several factors that affect learning to
program have been identified over the years, there continues to be no
indication of any consensus in understanding why some students learn
to program easily and quickly while others have difficulty. Seldom
have researchers considered the problem of how to help the students
enhance the programming learning outcome. The research had been
conducted at a high school in Taiwan. Students participating in the
study consist of 330 tenth grade students enrolled in the Basic
Computer Concepts course with the same instructor. Two types of
training methods-instruction-oriented and exploration-oriented were
conducted. The result of this research shows that the
instruction-oriented training method has better learning performance
than exploration-oriented training method.
Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: In this paper, a fifth order propagator operators are proposed for estimating the Angles Of Arrival (AOA) of narrowband electromagnetic waves impinging on antenna array when its number of sensors is larger than the number of radiating sources.
The array response matrix is partitioned into five linearly dependent phases to construct the noise projector using five different propagators from non diagonal blocks of the spectral matrice of the received data; hence, five different estimators are proposed to estimate the angles of the sources. The simulation results proved the performance of the proposed estimators in the presence of white noise comparatively to high resolution eigen based spectra.
Abstract: In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem. Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA).
Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.
Abstract: In recent years, geographic information systems (GIS)
and remote sensing using has increased to estimate runoff catchment.
In this research, runoff curve number maps for captive catchment of
Tehran by helping GIS and also remote sensing which based on
factors such as vegetation, lands using, group of soil hydrology and
hydrological conditions were obtained. Runoff curve numbers map
was obtained by combining these maps in ARC GIS and SCS table.
To evaluate the accuracy of the results, the maximum flow rate of
flood which was obtained from curve numbers, was compared with
the measured maximum flood rate at the watershed outlet and
correctness of curve numbers were approved.