Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Flanges are widely used for connecting valves, pipes and other industrial devices such as gearboxes. Method of producing a flange has a considerable impact on the manner of their involvement with the industrial engines and gearboxes. By Using die casting instead of sand casting and machining for manufacturing flanges, production speed and dimensional accuracy of the parts increases. Also, in die casting, obtained dimensions are close to final dimensions and hence the need for machining flanges after die casting process decreases which makes a significant savings in raw materials and improves the mechanical properties of flanges. In this paper, a typical die of an industrial helical gearbox flange (size ISO 50) was designed and die casting process for producing this type of flange was simulated using ProCAST software. The results of simulation were used for optimizing die design. Finally, using the results of the analysis, optimized die was built.
Abstract: Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.
Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: The Montreal protocol and Kyoto protocol underlined the need of substitution of CFC’s and HCFC’s due to their adverse impact on atmospheric ozone layer which protects earth from U.V rays. The CFCs have been entirely ruled out since 1995 and a long-term basis HCFCs must be replaced by 2020. All this events motivated HFC refrigerants which are harmless to ozone layer. In this paper thermodynamic analysis of cascade refrigeration system has been done using three different refrigerant pairs R13-R12, R290-R23, and R404A-R23. Effect of various operating parameters i.e. evaporator temperature, condenser temperature, temperature difference in cascade condenser and low temperature cycle condenser temperature on performance parameters viz. COP, exergetic efficiency and refrigerant mass flow ratio have been studied. Thermodynamic analysis shows that out of three refrigerant pairs R12-R13, R290-R23 and R404A-R23 the COP of R290-R23 refrigerant pair is highest.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: This paper is aimed to investigate farmers’ level of awareness and behavior of chemical pesticide uses, by using a case study of Suan Luang Sub- District Municipality, Ampawa, Samut Songkram Province. Questionnaire was employed in this study with the farmers from 46 households to explore their level of awareness in chemical pesticide uses, while interview and observation were adopted in exploring their behavior of chemical pesticide uses. The findings reflected the farmers’ high level of awareness in chemical pesticide uses in the hazardous effects of the chemical to human and environmental health, while their behavior of chemical pesticide uses explained their awareness paid to the right way of using pesticides, for instance reading the direction on the label, keeping children and animals away from the area of pesticide mixing, covering body with clothes and wearing hat and mask, no smoking, eating or drinking during pesticide spray or standing in windward direction.
Abstract: We installed solar panels and digital meteorological equipments whose electrical power is supplied using PV on July 13, 2011. Then, the relationship between the electric power generation and the irradiation, air temperature, and wind velocity was investigated on a roof at a university. The electrical power generation, irradiation, air temperature, and wind velocity were monitored over two years. By analyzing the measured meteorological data and electric power generation data using PTC, we calculated the size of the solar panel that is most suitable for this system. We also calculated the wasted power generation using PTC with the measured meteorological data obtained in this study. In conclusion, to reduce the "wasted power generation", a smaller-size solar panel is required for stable operation.
Abstract: In this paper, a fifth order propagator operators are proposed for estimating the Angles Of Arrival (AOA) of narrowband electromagnetic waves impinging on antenna array when its number of sensors is larger than the number of radiating sources.
The array response matrix is partitioned into five linearly dependent phases to construct the noise projector using five different propagators from non diagonal blocks of the spectral matrice of the received data; hence, five different estimators are proposed to estimate the angles of the sources. The simulation results proved the performance of the proposed estimators in the presence of white noise comparatively to high resolution eigen based spectra.
Abstract: In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem. Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA).
Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: High temperature is one of the most detrimental
effects that cause important changes in concrete’s mechanical,
physical, and thermo-physical properties. As a result of these
changes, especially high strength concrete (HSC), may exhibit
damages such as cracks and spallings. To overcome this problem,
incorporating polymer fibers such as polypropylene (PP) in concrete
is a very well-known method. In this study, using RRH, as a
sustainable material, instead of PP fiber in HSC to prevent spallings
and improve physical and thermo-physical properties were
investigated. Therefore, seven HSC mixtures with 0.25 water to
binder ratio were prepared incorporating silica fume and blast furnace
slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of
cement, respectively. All specimens were subjected to high
temperatures (20 (control), 300, 600 and 900˚C) with a heating rate
of 2.5˚C/min and after cooling, residual physical and thermo-physical
properties were determined.
Abstract: CNFET has emerged as an alternative material to
silicon for high performance, high stability and low power SRAM
design in recent years. SRAM functions as cache memory in
computers and many portable devices. In this paper, a new SRAM
cell design based on CNFET technology is proposed. The proposed
SRAM cell design for CNFET is compared with SRAM cell designs
implemented with the conventional CMOS and FinFET in terms of
speed, power consumption, stability, and leakage current. The
HSPICE simulation and analysis show that the dynamic power
consumption of the proposed 8T CNFET SRAM cell’s is reduced
about 48% and the SNM is widened up to 56% compared to the
conventional CMOS SRAM structure at the expense of 2% leakage
power and 3% write delay increase.
Abstract: The semiconductor industry is placing an increased
emphasis on emerging materials and devices that may provide
improved performance, or provide novel functionality for devices.
Recently, graphene, as a true two-dimensional carbon material, has
shown fascinating applications in electronics. In this paper detailed
discussions are introduced for possible applications of grapheme
Transistor in RF and digital devices.
Abstract: A forecasting model for steel demand uncertainty in Thailand is proposed. It consists of trend, autocorrelation, and outliers in a hierarchical Bayesian frame work. The proposed model uses a cumulative Weibull distribution function, latent first-order autocorrelation, and binary selection, to account for trend, time-varying autocorrelation, and outliers, respectively. The Gibbs sampling Markov Chain Monte Carlo (MCMC) is used for parameter estimation. The proposed model is applied to steel demand index data in Thailand. The root mean square error (RMSE), mean absolute percentage error (MAPE), and mean absolute error (MAE) criteria are used for model comparison. The study reveals that the proposed model is more appropriate than the exponential smoothing method.
Abstract: Non-synchronous breakage or line failure in power
systems with light or no loads can lead to core saturation in
transformers or potential transformers. This can cause component and
capacitance matching resulting in the formation of resonant circuits,
which trigger ferroresonance. This study employed a wavelet
transform for the detection of ferroresonance. Simulation results
demonstrate the efficacy of the proposed method.
Abstract: We present results from experimental price-setting oligopolies in which green firms undertake different levels of energy-saving investments motivated by public subsidies and demand-side advantages. We find that consumers reveal higher willingness to pay for greener sellers’ products. This observation in conjunction to the fact that greener sellers set higher prices is compatible with the use and interpretation of energy-saving behaviour as a differentiation strategy. However, sellers do not exploit the resulting advantage through sufficiently high price-cost margins, because they seem trapped into “run to stay still” competition. Regarding the use of public subsidies to energy-saving sellers we uncover an undesirable crowding-out effect of consumers’ intrinsic tendency to support green manufacturers. Namely, consumers may be less willing to support a green seller whose energy-saving strategy entails a direct financial benefit. Finally, we disentangle two alternative motivations for consumer’s attractions to pro-social firms; first, the self-interested recognition of the firm’s contribution to the public and private welfare and, second, the need to compensate a firm for the cost entailed in each pro-social action. Our results show the prevalence of the former over the latter.