Abstract: The Ballast Water Convention requires less than 5% of the world tonnage for ratification. Consequently, ships will have to comply with the requirements. Compliance evaluation and enforcement will become mandatory. Ship owners have to invest in treatment systems and shipboard personnel have to operate them and ensure compliance. The monitoring and enforcement will be the responsibilities of the Administrations. Herein, a review of the current status of the Ballast Water Management and the issues faced by these are projected. Issues range from efficacy and economics of the treatment systems to sampling and testing. Health issues of chemical systems, paucity of data for decision support etc., are other issues. It is emphasized that management of ballast water must be extended to ashore and sustainable solutions must be researched upon. An exemplar treatment system based on ship’s waste heat is also suggested.
Abstract: As a developing country, The Kingdom of Saudi Arabia (KSA) needs to make the best possible use of its workforce for social and economic reasons. The workforce is diverse, calling for appropriate diversity management (DM). The thesis focuses on the banking sector in KSA. To date, there have been no studies on DM in the banking sector in this country. Many organizations have introduced specific policies and programmes to improve the recruitment, inclusion, promotion, and retention of diverse employees, in addition to the legal requirements existing in many countries. However, Western-centric models of DM may not be applicable, at least not in their entirety, in other regions.
The aim of the study is to devise a framework for understanding gender, age and disability DM in the banking sector in KSA in order to enhance DM in this sector. A sample of 24 managers, 2 from each of the 12 banks, was interviewed to obtain their views on DM in the banking sector in KSA. Thematic analysis was used to analyze the data. These themes were used to develop the questionnaire, which was administered to 10 managers in each of the 12 banks. After analysis of these data, and completion of the study, the research will make a theoretical contribution to the knowledge on DM and a practical contribution to the management of diversity in Saudi banks. This paper concerns a work in progress.
Abstract: Combustion phenomenon will be accomplished
effectively by the development of low emission combustor. One of the
significant factors influencing the entire Combustion process is the
mixing between a swirling angular jet (Primary Air) and the
non-swirling inner jet (fuel). To study this fundamental flow, the
chamber had to be designed in such a manner that the combustion
process to sustain itself in a continuous manner and the temperature of
the products is sufficiently below the maximum working temperature
in the turbine. This study is used to develop the effective combustion
with low unburned combustion products by adopting the concept of
high swirl flow and motility of holes in the secondary chamber. The
proper selection of a swirler is needed to reduce emission which can be
concluded from the emission of Nox and CO2. The capture of CO2 is
necessary to mitigate CO2 emissions from natural gas. Thus the
suppression of unburned gases is a meaningful objective for the
development of high performance combustor without affecting turbine
blade temperature.
Abstract: Chittagong is the commercial capital of Bangladesh.
Here Agrabad is one of the most commercial activity centers of
Chittagong. Due to many light industry and commercial land use,
Agrabad to CEPZ road at Agrabad is the only major road of
Chittagong port city which encompasses a huge number of vehicles
every day. It has many junctions which distribute traffic flow in
different roads. In these junctions vehicles gather at some conflict
point to create traffic jam and make the performance of the road
downward. This study is parallel focused on the existing level of
service with traffic volume, capacity, and speed by traffic survey.
After all of these analyses the performance of the road is determined
with finding the factors that influences the performance.
Abstract: This investigation develops a revisable method for estimating the estimate value of equivalent 10 Hz voltage flicker (DV10) of a DC Electric Arc Furnace (EAF). This study also discusses three 161kV DC EAFs by field measurement, with those results indicating that the estimated DV10 value is significantly smaller than the survey value. The key point is that the conventional means of estimating DV10 is inappropriate. There is a main cause as the assumed Qmax is too small.
Although DC EAF is regularly operated in a constant MVA mode, the reactive power variation in the Main Transformer (MT) is more significant than that in the Furnace Transformer (FT). A substantial difference exists between estimated maximum reactive power fluctuation (DQmax) and the survey value from actual DC EAF operations. However, this study proposes a revisable method that can obtain a more accurate DV10 estimate than the conventional method.
Abstract: According to the scientific information management literature, the improper use of information technology (e.g. personal computers) by employees are one main cause for operational and information security loss events. Therefore, organizations implement information security awareness programs to increase employees’ awareness to further prevention of loss events. However, in many cases these information security awareness programs consist of conventional delivery methods like posters, leaflets, or internal messages to make employees aware of information security policies. We assume that a viral information security awareness video might be more effective medium than conventional methods commonly used by organizations. The purpose of this research is to develop a viral video artifact to improve employee security behavior concerning information technology.
Abstract: Background: The high prevalence of obesity in Egypt has a great impact on the health care system, economic and social situation. Evidence suggests that even a moderate amount of weight loss can be useful. Aim of the study: To analyze the effects of lower body positive pressure supported treadmill training, conducted with hypocaloric diet, on body composition of obese children. Methods: Thirty children aged between 8 and 14 years, were randomly assigned into two groups: intervention group (15 children) and control group (15 children). All of them were evaluated using body composition analysis through bioelectric impedance. The following parameters were measured before and after the intervention: body mass, body fat mass, muscle mass, body mass index (BMI), percentage of body fat and basal metabolic rate (BMR). The study group exercised with antigravity treadmill three times a week during 2 months, and participated in a hypocaloric diet program. The control group participated in a hypocaloric diet program only. Results: Both groups showed significant reduction in body mass, body fat mass and BMI. Only study group showed significant reduction in percentage of body fat (p = 0.0.043). Changes in muscle mass and BMR didn't reach statistical significance in both groups. No significant differences were observed between groups except for muscle mass (p = 0.049) and BMR (p = 0.042) favoring study group. Conclusion: Both programs proved effective in the reduction of obesity indicators, but lower body positive pressure supported treadmill training was more effective in improving muscle mass and BMR.
Abstract: Except for the internal aspects of entrepreneurship (i.e.motivation, opportunity perspective and alertness), there are external aspects that affecting entrepreneurship (i.e. the industrial cluster). By comparing the machinery companies located inside and outside the industrial district, this study aims to explore the cluster effects on the entrepreneurship of companies in Taiwan machinery clusters (TMC). In this study, three factors affecting the entrepreneurship in TMC are conducted as “competition”, “embedded-ness” and “specialized knowledge”. The “competition” in the industrial cluster is defined as the competitive advantages that companies gain in form of demand effects and diversified strategies; the “embedded-ness” refers to the quality of company relations (relational embedded-ness) and ranges (structural embedded-ness) with the industry components (universities, customers and complementary) that affecting knowledge transfer and knowledge generations; the “specialized knowledge” shares theinternal knowledge within industrial clusters. This study finds that when comparing to the companieswhich are outside the cluster, the industrial cluster has positive influence on the entrepreneurship. Additionally, the factor of “relational embedded-ness” has significant impact on the entrepreneurship and affects the adaptation ability of companies in TMC. Finally, the factor of “competition” reveals partial influence on the entrepreneurship.
Abstract: Blood gamma irradiation is the only available method
to prevent transfusion associated graft versus host disease (TAGVHD).
However, when blood is irradiated, determine blood shelf
time is crucial. Non irradiated blood have a self-time from 21 to 35
days when is preserved with anticoagulated solution and stored at
4°C. During their storage, red blood cells (RBC) undergo a series of
biochemical, biomechanical and molecular changes involving what is
known as storage lesion (SL). SL include loss of structural integrity
of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and
increase of both ion potassium concentration and hemoglobin (Hb).
On the other hand, Atomic force Microscopy (AFM) represents a
versatile tool for a nano-scale high resolution topographic analysis in
biological systems. In order to evaluate SL in irradiated and nonirradiated
blood, RBC topography and morphometric parameters
were obtained from an AFM XE-BIO system. Cell viability was
followed using flow cytometry. Our results showed that early
markers as nanoscale roughness, allow us to evaluate blood quality
since other perspective.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: Flanges are widely used for connecting valves, pipes and other industrial devices such as gearboxes. Method of producing a flange has a considerable impact on the manner of their involvement with the industrial engines and gearboxes. By Using die casting instead of sand casting and machining for manufacturing flanges, production speed and dimensional accuracy of the parts increases. Also, in die casting, obtained dimensions are close to final dimensions and hence the need for machining flanges after die casting process decreases which makes a significant savings in raw materials and improves the mechanical properties of flanges. In this paper, a typical die of an industrial helical gearbox flange (size ISO 50) was designed and die casting process for producing this type of flange was simulated using ProCAST software. The results of simulation were used for optimizing die design. Finally, using the results of the analysis, optimized die was built.
Abstract: Although several factors that affect learning to
program have been identified over the years, there continues to be no
indication of any consensus in understanding why some students learn
to program easily and quickly while others have difficulty. Seldom
have researchers considered the problem of how to help the students
enhance the programming learning outcome. The research had been
conducted at a high school in Taiwan. Students participating in the
study consist of 330 tenth grade students enrolled in the Basic
Computer Concepts course with the same instructor. Two types of
training methods-instruction-oriented and exploration-oriented were
conducted. The result of this research shows that the
instruction-oriented training method has better learning performance
than exploration-oriented training method.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: In this paper, a fifth order propagator operators are proposed for estimating the Angles Of Arrival (AOA) of narrowband electromagnetic waves impinging on antenna array when its number of sensors is larger than the number of radiating sources.
The array response matrix is partitioned into five linearly dependent phases to construct the noise projector using five different propagators from non diagonal blocks of the spectral matrice of the received data; hence, five different estimators are proposed to estimate the angles of the sources. The simulation results proved the performance of the proposed estimators in the presence of white noise comparatively to high resolution eigen based spectra.
Abstract: In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem. Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA).
Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: High temperature is one of the most detrimental
effects that cause important changes in concrete’s mechanical,
physical, and thermo-physical properties. As a result of these
changes, especially high strength concrete (HSC), may exhibit
damages such as cracks and spallings. To overcome this problem,
incorporating polymer fibers such as polypropylene (PP) in concrete
is a very well-known method. In this study, using RRH, as a
sustainable material, instead of PP fiber in HSC to prevent spallings
and improve physical and thermo-physical properties were
investigated. Therefore, seven HSC mixtures with 0.25 water to
binder ratio were prepared incorporating silica fume and blast furnace
slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of
cement, respectively. All specimens were subjected to high
temperatures (20 (control), 300, 600 and 900˚C) with a heating rate
of 2.5˚C/min and after cooling, residual physical and thermo-physical
properties were determined.