Abstract: Segmentation is one of the essential tasks in image
processing. Thresholding is one of the simplest techniques for
performing image segmentation. Multilevel thresholding is a simple
and effective technique. The primary objective of bi-level or
multilevel thresholding for image segmentation is to determine a best
thresholding value. To achieve multilevel thresholding various
techniques has been proposed. A study of some nature inspired
metaheuristic algorithms for multilevel thresholding for image
segmentation is conducted. Here, we study about Particle swarm
optimization (PSO) algorithm, artificial bee colony optimization
(ABC), Ant colony optimization (ACO) algorithm and Cuckoo
search (CS) algorithm.
Abstract: In the present work, the effects of additives, including
contents of the added antioxidants and type of the selected metallic
stearates (either calcium stearate (CaSt) or zinc stearate (ZnSt)), on
the thermal stabilities of carbon black (CB)/high density polyethylene
(HDPE) compounds were studied. The results showed that the AO
contents played a key role in the thermal stabilities of the CB/HDPE
compounds — the higher the AO content, the higher the thermal
stabilities. Although the CaSt-containing compounds were slightly
superior to those with ZnSt in terms of the thermal stabilities, the
remaining solid residue of CaSt after heated to the temperature of 600
°C (mainly calcium carbonate (CaCO3) as characterized by the X-ray
diffraction (XRD) technique) seemed to catalyze the decomposition
of CB in the HDPE-based compounds. Hence, the quantification of
CB in the CaSt-containing compounds with a muffle furnace gave an
inaccurate CB content — much lower than actual value. However,
this phenomenon was negligible in the ZnSt-containing system.
Abstract: The majority of contemporary insulation materials
commonly used in the building industry is made from non-renewable
raw materials; furthermore, their production often brings high energy
costs. A long-term trend as far as sustainable development is
concerned has been the reduction of energy and material demands of
building material production. One of the solutions is the possibility of
using easily renewable natural raw material sources which are
considerably more ecological and their production is mostly less
energy-consuming compared to the production of normal insulations
(mineral wool, polystyrene). The paper describes the results of
research focused on the development of thermal and acoustic
insulation materials based on natural fibres intended for floor
constructions. Given the characteristic open porosity of natural fibre
materials, the hygrothermal behaviour of the developed materials was
studied. Especially the influence of relative humidity and temperature
on thermal insulation properties was observed.
Abstract: The lactic acid bacteria (LAB) were isolated from
10 samples of fermented foods (Sa-tor-dong and Bodo) in South
locality of Thailand. The 23 isolates of lactic acid bacteria were
selected, which were exhibited a clear zone and growth on MRS
agar supplemented with CaCO3. All of lactic acid bacteria were
tested on morphological and biochemical. The result showed that
all isolates were Gram’s positive, non-spore forming but only
10 isolates displayed catalase negative. The 10 isolates including
BD1 .1, BD 1.2, BD 2.1, BD2.2, BD 2.3, BD 3.1, BD 4.1, BD 5.2,
ST 4.1 and ST 5.2 were selected for inhibition activity
determination. Only 2 strains (ST 4.1 and BD 2.3) showed
inhibition zone on agar, when using Escherichia coli sp. as target
strain. The ST 4.1 showed highest inhibition zone on agar, which
was selected for probiotic property testing. The ST4.1 isolate
could grow in MRS broth containing a high concentration of
sodium chloride 6%, bile salts 7%, pH 4-10 and vary temperature
at 15-45°C.
Abstract: A method is proposed for stable detection of
seismoacoustic sources in C-OTDR systems that guarantee given
upper bounds for probabilities of type I and type II errors. Properties
of the proposed method are rigorously proved. The results of
practical applications of the proposed method in a real C-OTDRsystem
are presented.
Abstract: Analysis of real life problems often results in linear
systems of equations for which solutions are sought. The method to
employ depends, to some extent, on the properties of the coefficient
matrix. It is not always feasible to solve linear systems of equations
by direct methods, as such the need to use an iterative method
becomes imperative. Before an iterative method can be employed
to solve a linear system of equations there must be a guaranty that
the process of solution will converge. This guaranty, which must
be determined apriori, involve the use of some criterion expressible
in terms of the entries of the coefficient matrix. It is, therefore,
logical that the convergence criterion should depend implicitly on the
algebraic structure of such a method. However, in deference to this
view is the practice of conducting convergence analysis for Gauss-
Seidel iteration on a criterion formulated based on the algebraic
structure of Jacobi iteration. To remedy this anomaly, the Gauss-
Seidel iteration was studied for its algebraic structure and contrary
to the usual assumption, it was discovered that some property of the
iteration matrix of Gauss-Seidel method is only diagonally dominant
in its first row while the other rows do not satisfy diagonal dominance.
With the aid of this structure we herein fashion out an improved
version of Gauss-Seidel iteration with the prospect of enhancing
convergence and robustness of the method. A numerical section is
included to demonstrate the validity of the theoretical results obtained
for the improved Gauss-Seidel method.
Abstract: Osteoporosis is a common multifactorial disease with
a strong genetic component characterized by reduced bone mass and
increased risk of fractures. Genetic factors play an important role in
the pathogenesis of osteoporosis. The aim of our study was to
identify the genotype and allele distribution of T245G polymorphism
in OPG gene in Slovak postmenopausal women. A total of 200
unrelated Slovak postmenopausal women with diagnosed
osteoporosis and 200 normal controls were genotyped for T245G
(rs3134069) polymorphism of OPG gene. Genotyping was performed
using the Custom Taqman®SNP Genotyping assays. Genotypes and
alleles frequencies showed no significant differences (p=0.5551;
p=0.6022). The results of the present study confirm the importance of
T245G polymorphism in OPG gene in the pathogenesis of
osteoporosis.
Abstract: The present environmental issues have made aircraft jet noise reduction a crucial problem in aero-acoustics research. Acoustic studies reveal that addition of chevrons to the nozzle reduces the sound pressure level reasonably with acceptable reduction in performance. In this paper comprehensive numerical studies on acoustic characteristics of different types of chevron nozzles have been carried out with non-reacting flows for the shape optimization of chevrons in supersonic nozzles for aerospace applications. The numerical studies have been carried out using a validated steady 3D density based, k-ε turbulence model. In this paper chevron with sharp edge, flat edge, round edge and U-type edge are selected for the jet acoustic characterization of supersonic nozzles. We observed that compared to the base model a case with round-shaped chevron nozzle could reduce 4.13% acoustic level with 0.6% thrust loss. We concluded that the prudent selection of the chevron shape will enable an appreciable reduction of the aircraft jet noise without compromising its overall performance. It is evident from the present numerical simulations that k-ε model can predict reasonably well the acoustic level of chevron supersonic nozzles for its shape optimization.
Abstract: The study explored the role of metacognition in foreign language anxiety on a sample of 411 Taiwanese students of English as a Foreign Language. The reading strategy inventory was employed to evaluate the tertiary learners’ level of metacognitive awareness and a semi-structured background questionnaire was also used to examine the learners’ perceptions of their English proficiency and satisfaction of their current English learning. In addition, gender and academic level differences in employment of reading strategies were investigated. The results showed the frequency of reading strategy use increase slightly along with academic years and males and females actually employ different reading strategies. The EFL tertiary learners in the present study utilized cognitive strategies more frequently than metacognitive strategies or support strategies. Male students use metacognitive strategy more often while female students use cognitive and support strategy more frequently.
Abstract: Photoacoustic imaging (PAI) is a non-invasive and
non-ionizing imaging modality that combines the absorption contrast
of light with ultrasound resolution. Laser is used to deposit optical
energy into a target (i.e., optical fluence). Consequently, the target
temperature rises, and then thermal expansion occurs that leads to
generating a PA signal. In general, most image reconstruction
algorithms for PAI assume uniform fluence within an imaging object.
However, it is known that optical fluence distribution within the
object is non-uniform. This could affect the reconstruction of PA
images. In this study, we have investigated the influence of optical
fluence distribution on PA back-propagation imaging using finite
element method. The uniform fluence was simulated as a triangular
waveform within the object of interest. The non-uniform fluence
distribution was estimated by solving light propagation within a
tissue model via Monte Carlo method. The results show that the PA
signal in the case of non-uniform fluence is wider than the uniform
case by 23%. The frequency spectrum of the PA signal due to the
non-uniform fluence has missed some high frequency components in
comparison to the uniform case. Consequently, the reconstructed
image with the non-uniform fluence exhibits a strong smoothing
effect.
Abstract: The sound pressure level (SPL) of the moving-coil
loudspeaker (MCL) is often simulated and analyzed using the lumped
parameter model. However, the SPL of a MCL cannot be simulated
precisely in the high frequency region, because the value of cone
effective area is changed due to the geometry variation in different
mode shapes, it is also related to affect the acoustic radiation mass and
resistance. Herein, the paper presents the inverse method which has a
high ability to measure the value of cone effective area in various
frequency points, also can estimate the MCL electroacoustic
parameters simultaneously. The proposed inverse method comprises
the direct problem, adjoint problem, and sensitivity problem in
collaboration with nonlinear conjugate gradient method. Estimated
values from the inverse method are validated experimentally which
compared with the measured SPL curve result. Results presented in
this paper not only improve the accuracy of lumped parameter model
but also provide the valuable information on loudspeaker cone design.
Abstract: In this paper, we propose a smart music player that combines the musical genre classification and the spatial audio processing. The musical genre is classified based on content analysis of the musical segment detected from the audio stream. In parallel with the classification, the spatial audio quality is achieved by adding an artificial reverberation in a virtual acoustic space to the input mono sound. Thereafter, the spatial sound is boosted with the given frequency gains based on the musical genre when played back. Experiments measured the accuracy of detecting the musical segment from the audio stream and its musical genre classification. A listening test was performed based on the virtual acoustic space based spatial audio processing.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: With the increasing popularity of the Internet, online reading has become an essential source for EFL readers. Using strategies to comprehend information on online reading texts play a crucial role in students’ academic success. Metacognitive reading strategies are effective factors that enhance EFL learners reading comprehension. This study aimed at exploring the use of online metacognitive reading strategies by postgraduate Libyan EFL students. Quantitative data was collected using the Survey of Online Reading Strategies (OSORS). The findings revealed that the participants were moderate users of metacognitive online reading strategies. Problem solving strategies were the most frequently reported used strategies, while support reading strategies were the least. The five most and least frequently reported strategies were identified. Based on the findings, some future research recommendations were presented.
Abstract: The aim of the current research was to determine
quality parameters changes of dried venison during storage. Protein,
fat and moisture content dynamics as well microbiological quality
was analyzed. For the experiments the meat (0.02×4.00×7.00 cm)
pieces were marinated in “teriyaki sauce” marinade (composition:
teriyaki sauce, sweet and sour sauce, taco sauce, soy sauce, American
BBQ sauce hickory, sesame oil, garlic, garlic salt, tabasco red pepper
sauce) at 4±2°C temperature for 48±1h. Sodium monophosphate
(E339) was also added in part of marinade to improve the meat
textural properties. After marinating, meat samples were dried in
microwave-vacuum drier MUSSON–1, packaged in vacuum pouches
made from polymer film (PA/PE) with barrier properties and storage
for 4 months at 18±1°C temperature in dark place. Dried venison
samples were analyzed after 0, 35, 91 and 112 days of storage.
During the storage total plate counts of dried venison samples
significantly (p
Abstract: To develop the useful acoustic environmental
recognition system, the method of estimating 3D-position of a
stationary random acoustic source using bispectral analysis of
4-point detected signals is proposed. The method uses information
about amplitude attenuation and propagation delay extracted from
amplitude ratios and angles of auto- and cross-bispectra of the
detected signals. It is expected that using bispectral analysis affects
less influence of Gaussian noises than using conventional power
spectral one. In this paper, the basic principle of the method is
mentioned first, and its validity and features are considered from
results of the fundamental experiments assumed ideal circumstances.
Abstract: Recently in Malaysia, women's participation in teaching profession has increased. The increasing trend of women’s participation in the teaching profession poses challenges in families, especially in the developing countries like Malaysia. One of these challenges, concerns in balancing their role between family and job responsibility that faced by many women teachers. The purpose of this study is to discover how women teachers' impact on family happiness and the challenges faced by them in balancing their role between family and job responsibility. The findings presented in this study are based on survey research in a secondary school Dato’ Bijaya Setia in the district of Gugusan Manjoi which is located in Kedah, Malaysia. The study found that employment of women in economic activity has several beneficial impacts of improving the economic condition of the family. The results also revealed that in low income earning families, both husbands and wives’ employment contribute to the family income that less likely to experience of family poverty. The study also showed despite women's teachers’ significant role towards the overall development of the family, the majority of women teachers encountered a number of difficulties in balancing their role between family and job responsibility especially when they need to work more than the normal working time. Therefore, it is common for the majority of women suffering from psychological stress when they are unable to complete the task at a fixed time. The present study also suggests implication of family friendly policy and its appropriate practice to support the women teachers who are significantly contributing to family, community and the country.
Abstract: Metacognitive knowledge increases EFL students’ ability to be successful learners. Although this relationship has been investigated by a number of scholars, EFL teachers’ explicit awareness of their cognitive knowledge has not been sufficiently explored. The aim of this study was to examine the role of EFL teachers’ metacognitive knowledge in their pedagogical performance. Furthermore, the role played by years of their academic education and teaching experience was also studied. Fifty female EFL teachers were selected. They completed Metacognitive Awareness Inventory (MAI) that assessed six components of metacognition including procedural knowledge, declarative knowledge, conditional knowledge, planning, evaluating, and management strategies. Near the end of the academic semester, the students of each class filled in ‘the Language Teacher Characteristics Questionnaire’ to evaluate their teachers’ pedagogical performance. Four elements of MAI, declarative knowledge, planning, evaluating, and management strategies were found to be significantly correlated with EFL teachers’ pedagogical success. Significant correlation was also established between metacognitive knowledge and EFL teachers’ years of academic education and teaching experience. The findings obtained from this research have contributing implication for EFL teacher educators. The discussion concludes by setting out directions for future research.
Abstract: In the era of sustainability, utilization of livestock wastes as soil amendment to provide micronutrients for crops is very economical and sustainable. It is well understood that livestock wastes are comparable, if not better, nutrient sources for crops as chemical fertilizers. However, the large concentrated volumes of animal manure produced from livestock operations and the limited amount of available nearby agricultural land areas necessitated the need for volume reduction of these animal wastes. Composting of these animal manures is a viable option for biomass and pathogenic reduction in the environment. Nevertheless, composting also increases the potential loss of available nutrients for crop production as well as unwanted emission of anthropogenic air pollutants due to the loss of ammonia and other compounds via volatilization. In this study, we examine the emission of ammonia and nitrous oxide from swine manure windrows to evaluate the benefit of biomass reduction in conjunction with the potential loss of available nutrients. The feedstock for the windrows was obtained from swine farm in Kentucky where swine manure was mixed with wood shaving as absorbent material. Static flux chambers along with photoacoustic gas analyzer were used to monitor ammonia and nitrous oxide concentrations during the composting process. The results show that ammonia and nitrous oxide fluxes were quite high during the initial composting process and after the turning of each compost pile. Over the period of roughly three months of composting, the biochemical oxygen demand (BOD) decreased by about 90%. Although composting of animal waste is quite beneficial for biomass reduction, composting may not be economically feasible from an agronomical point of view due to time, nutrient loss (N loss), and potential environmental pollution (ammonia and greenhouse gas emissions). Therefore, additional studies are needed to assess and validate the economics and environmental impact of animal (swine) manure composting (e.g., crop yield or impact on climate change).
Abstract: The aim of this paper is to summarize the literature on micromorphology and composition of the enamel of the cat and present an original experiment by SEM on how it responds to the etching with ortophosphoric acid for the time recommended in the veterinary literature (30", 45", 60"), derived from research and experience on human enamel; 21 teeth of cat were randomly divided into three groups of 7 (A, B, C): Group A was subjected to etching for 30 seconds by means of orthophosphoric acid to 40% on a circular area with diameter of about 2mm of the enamel coronal; the Groups B and C had the same treatment but, respectively, for 45 and 60 seconds. The samples obtained were observed by SEM to constant magnification of 1000x framing, in particular, the border area between enamel exposed and not exposed to etching to highlight differences. The images were subjected to the analysis of three blinded experienced operators in electron microscopy. In the enamel of the cat the etching for the times considered is not optimally effective for the purpose adhesives and the presence of a thick prismless layer could explain this situation. To improve this condition may clinically in the likeness of what is proposed for the enamel of human deciduous teeth: a bevel or a chamfer of 1 mm on the contour of the cavity to discover the prismatic enamel and increase the bonding surface.