Abstract: The most important problem occurs on oil spills in sea
water is to reduce the oil spills size. This study deals with the
development of high pressurized nozzle using dispersion method for
oil leakage in offshore. 3D numerical simulation results were
obtained using ANSYS Fluent 13.0 code and correlate with the
experimental data for validation. This paper studies the contribution
of the process on flow speed and pressure of the flow from two
different geometrical designs of nozzles and to generate a spray
pattern suitable for dispersant application. Factor of size distribution
of droplets generated by the nozzle is calculated using pressures
ranging from 2 to 6 bars. Results obtain from both analyses shows a
significant spray pattern and flow distribution as well as distance.
Results also show a significant contribution on the effect of oil
leakage in terms of the diameter of the oil spills break up.
Abstract: Vertical slotted walls can be used as permeable
breakwaters to provide economical and environmental protection
from undesirable waves and currents inside the port. The permeable
breakwaters are partially protection and have been suggested to
overcome the environmental disadvantages of fully protection
breakwaters. For regular waves a semi-analytical model is based on
an eigenfunction expansion method and utilizes a boundary condition
at the surface of each wall are developed to detect the energy
dissipation through the slots. Extensive laboratory tests are carried
out to validate the semi-analytic models. The structure of the physical
model contains two walls and it consists of impermeable upper and
lower part, where the draft is based a decimal multiple of the total
depth. The middle part is permeable with a porosity of 50%. The
second barrier is located at a distant of 0.5, 1, 1.5 and 2 times of the
water depth from the first one. A comparison of the theoretical results
with previous studies and experimental measurements of the present
study show a good agreement and that, the semi-analytical model is
able to adequately reproduce most the important features of the
experiment.
Abstract: Information technology is changing rapidly and the users’ expectations are also growing. Dealing with these changes in information technology, while satisfying the users’ needs and expectations is a big challenge. IT managers need to explore new mechanisms/strategies to enable them to cope with such challenges.
The objectives of this research are to identify the significant challenges that might face IT managers in higher education institutes in the face of the high and ever growing customer expectations and to propose possible solutions to cope with such high-speed changes in information technology.
To achieve these objectives, interviews with the IT professionals from different higher education institutes in Oman were conducted. In addition, documentation (printed and online) related to these institutions were studied and an intensive literature review of published work was examined.
The findings of this research are expected to give a better understanding of the challenges that might face the IT managers at higher education institutes. This acquired understanding is expected to highlight the importance of being adaptable and fast in keeping up with the ever-growing technological changes. Moreover, adopting different tools and technologies could assist IT managers in developing their organisations’ IT policies and strategies.
Abstract: Recently there has been a dramatic proliferation in
the number of social networking sites (SNSs) users; however, little
is published about what motivates college students to use SNSs in
education. The main goal of this research is to explore the college
students’ motives for using SNSs in education. A conceptual
framework has therefore been developed to identify the main
factors that influence/motivate students to use social networking
sites for learning purposes. To achieve the research objectives a
quantitative method was used to collect data. A questionnaire has
been distributed amongst college students. The results reveal that
social influence, perceived enjoyment, institute regulation,
perceived usefulness, ranking up-lift, attractiveness,
communication tools, free of charge, sharing material and course
nature all play an important role in the motivation of college
students to use SNSs for learning purposes.
Abstract: Compost can influence soil fertility and plant health. At the same time compost can play an important role in the nitrogen cycle and it can influence leaching of mineral nitrogen from soil to underground water.
This paper deals with the influence of compost addition and mineral nitrogen fertilizer on leaching of mineral nitrogen, nitrogen availability in microbial biomass and plant biomass production in the lysimetric experiment. Twenty one lysimeters were filed with topsoil and subsoil collected in the area of protection zone of underground source of drinking water - Březová nad Svitavou. The highest leaching of mineral nitrogen was detected in the variant fertilized only mineral nitrogen fertilizer (624.58 mg m-2), the lowest leaching was recorded in the variant with high addition of compost (315.51 mg m-2). On the other hand, losses of mineral nitrogen are not in connection with the losses of available form of nitrogen in microbial biomass. Because lost of mineral nitrogen was detected in variant with the least change in the availability of N in microbial biomass.
The leaching of mineral nitrogen, yields as well as the results concerning nitrogen availability from the first year of long term experiment suggest that compost can positive influence the leaching of nitrogen into underground water.
Abstract: Each of the countries around the world has different
ways of management and many of them depend on people to
administrate their country. Thailand, for example, empowers the
sovereignty of Thai people under constitution; however, our Thai
voting system is not able to flow fast enough under the current
Political management system. The sovereignty of Thai people is
addressing this problem through representatives during current
elections, in order to set a new policy for the countries ideology to
change in the House and the Cabinet.
This is particularly important in a democracy to be developed
under our current political institution. The Organic Act on Political
Parties 2007 is the establishment we have today that is causing
confrontations within the establishment. There are many political
parties that will soon be abolished. Many political parties have
already been subsidized. This research study is to analyze the legal
problems with the political party establishment under the Organic Act
on Political Parties 2007.
This will focus on the freedom of each political establishment
compared to an effective political operation. Textbooks and academic
papers will be referenced from studies home and abroad.
The study revealed that Organic Act on Political Parties 2007 has
strict provisions on the political structure over the number of
members and the number of branches involved within political
parties system.
Such operations shall be completed within one year; but under the
existing laws the small parties are not able to participate with the
bigger parties. The cities are capable of fulfilling small political party
requirements but fail to become coalesced because the current laws
won't allow them to be united as one. It is important to allow all
independent political parties to join our current political structure.
Board members can’t help the smaller parties to become a large
organization under the existing Thai laws.
Creating a new establishment that functions efficiently throughout
all branches would be one solution to these legal problems between
all political parties. With this new operation, individual political
parties can participate with the bigger parties during elections. Until
current political institutions change their system to accommodate
public opinion, these current Thai laws will continue to be a problem
with all political parties in Thailand.
Abstract: Data Grid is a geographically distributed environment that deals with data intensive application in scientific and enterprise computing. Data replication is a common method used to achieve efficient and fault-tolerant data access in Grids. In this paper, a dynamic data replication strategy, called Enhanced Latest Access Largest Weight (ELALW) is proposed. This strategy is an enhanced version of Latest Access Largest Weight strategy. However, replication should be used wisely because the storage capacity of each Grid site is limited. Thus, it is important to design an effective strategy for the replication replacement task. ELALW replaces replicas based on the number of requests in future, the size of the replica, and the number of copies of the file. It also improves access latency by selecting the best replica when various sites hold replicas. The proposed replica selection selects the best replica location from among the many replicas based on response time that can be determined by considering the data transfer time, the storage access latency, the replica requests that waiting in the storage queue and the distance between nodes. Simulation results utilizing the OptorSim show our replication strategy achieve better performance overall than other strategies in terms of job execution time, effective network usage and storage resource usage.
Abstract: This study investigates the role and impact of English loan words on Japanese language in travel brochures. The issues arising from a potential switch to English as a tool to absorb the West’s advanced knowledge and technology in the modernization of Japan to a means of linking Japan with the rest of the world and enhancing the country’s international presence. Sociolinguistic contexts was used to analyze data collected from the Nippon Travel agency "HIS"’s brochures in Thailand, revealing that English plays the most important role as lexical gap fillers and special effect givers. An increasing mixer of English to Japanese affects how English is misused, the way the Japanese see the world and the present generation’s communication gap.
Abstract: Tsunami early detection and warning systems have proved to be of ultimate importance, especially after the destructive tsunami that hit Japan in March 2012. Such systems are crucial to inform the authorities of any risk of a tsunami and of the degree of its danger in order to make the right decision and notify the public of the actions they need to take to save their lives. The purpose of this research is to enhance existing tsunami detection and warning systems. We first propose an automated and miniaturized model of an early tsunami detection and warning system. The model for the operation of a tsunami warning system is simulated using the data acquisition toolbox of Matlab and measurements acquired from specified internet pages due to the lack of the required real-life sensors, both seismic and hydrologic, and building a graphical user interface for the system. In the second phase of this work, we implement various satellite image filtering schemes to enhance the acquired synthetic aperture radar images of the tsunami affected region that are masked by speckle noise. This enables us to conduct a post-tsunami damage extent study and calculate the percentage damage. We conclude by proposing improvements to the existing telecommunication infrastructure of existing warning tsunami systems using a migration to IP-based networks and fiber optics links.
Abstract: Sustainable urban waterfront development is one of the
most interesting phenomena of urban renewal in the last decades.
However, there are still many cities whose visual image is
compromised due to the lack of a sustainable urban waterfront
development, which consequently affects the place of those cities
globally. This paper aims to reimagine the role of waterfront areas in
city design, with a particular focus on Egypt, so that they provide
attractive, sustainable urban environments while promoting the
continued aesthetic development of the city overall. This aim will be
achieved by determining the main principles of a sustainable urban
waterfront and its applications. This paper concentrates on
sustainability assessment rating systems. A number of international
case-studies, wherein a city has applied the basic principles for a
sustainable urban waterfront and have made use of sustainability
assessment rating systems, have been selected as examples which can
be applied to the urban waterfronts in Egypt. This paper establishes the
importance of developing the design of urban environments in Egypt,
as well as identifying the methods of sustainability application for
urban waterfronts.
Abstract: Generally, distributed generation units refer to small-scale electric power generators that produce electricity at a site close to the customer or an electric distribution system (in parallel mode). From the customers’ point of view, a potentially lower cost, higher service reliability, high power quality, increased energy efficiency, and energy independence can be the key points of a proper DG unit. Moreover, the use of renewable types of distributed generations such as wind, photovoltaic, geothermal or hydroelectric power can also provide significant environmental benefits. Therefore, it is of crucial importance to study their impacts on the distribution networks. A marked increase in Distributed Generation (DG), associated with medium voltage distribution networks, may be expected. Nowadays, distribution networks are planned for unidirectional power flows that are peculiar to passive systems, and voltage control is carried out exclusively by varying the tap position of the HV/MV transformer. This paper will compare different DG control methods and possible network reconfiguration aimed at assessing their effect on voltage profiles.
Abstract: Castor (Ricinus communis L.) is one of the important
non-edible oilseed crops having immense industrial and medicinal
value. Oil yield per unit area is the ultimate target in growing oilseed
plants and sowing date is one of the important factors which have a
clear role on production of active substances particularly in oilseeds.
This study was conducted to evaluate the effect of sowing date on the
seed and oil yield of castor in Central Anatolia of Turkey in 2011.
The field experiment was set up in a completely randomized block
design with three replications. Black Diamond-2 castor cultivar was
used as plant material. The treatment was four sowing dates of May
10, May 25, June 10, June 25. In this research; seed yield, oil content
and oil yield were investigated. Results showed that the effect of
different sowing dates were significant on all of characteristics. In
general; delayed sowing dates, resulted in decreased seed yield, oil
content and oil yield. The highest value of seed yield, oil content and
oil yield (respectively, 2523.7 kg ha-1, 51.18% and 1292.2 kg ha-1)
were obtained from the first sowing date (May 10) while the lowest
seed yield, oil content and oil yield (respectively, 1550 kg ha-1,
43.67%, 677.3 kg ha-1) were recorded from the latest sowing date
(June 25). Therefore, it can be concluded that early May could be
recommended as an appropriate sowing date in the studied location
and similar climates for achieved high oil yield of castor.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.
Abstract: Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: High temperature is one of the most detrimental
effects that cause important changes in concrete’s mechanical,
physical, and thermo-physical properties. As a result of these
changes, especially high strength concrete (HSC), may exhibit
damages such as cracks and spallings. To overcome this problem,
incorporating polymer fibers such as polypropylene (PP) in concrete
is a very well-known method. In this study, using RRH, as a
sustainable material, instead of PP fiber in HSC to prevent spallings
and improve physical and thermo-physical properties were
investigated. Therefore, seven HSC mixtures with 0.25 water to
binder ratio were prepared incorporating silica fume and blast furnace
slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of
cement, respectively. All specimens were subjected to high
temperatures (20 (control), 300, 600 and 900˚C) with a heating rate
of 2.5˚C/min and after cooling, residual physical and thermo-physical
properties were determined.
Abstract: Localization of mobile robots are important tasks for
developing autonomous mobile robots. This paper proposes a method
to estimate positions of a mobile robot using a omnidirectional
camera on the robot. Landmarks for points of references are set
up on a field where the robot works. The omnidirectional camera
which can obtain 360 [deg] around images takes photographs of
these landmarks. The positions of the robots are estimated from
directions of these landmarks that are extracted from the images
by image processing. This method can obtain the robot positions
without accumulative position errors. Accuracy of the estimated
robot positions by the proposed method are evaluated through some
experiments. The results show that it can obtain the positions with
small standard deviations. Therefore the method has possibilities of
more accurate localization by tuning of appropriate offset parameters.
Abstract: In the last few years, harmonics have been occurred
with the increasing use of nonlinear loads, and these harmonics have
been an ever increasing problem for the line systems. This situation
importantly affects the quality of power and gives large losses to the
network. An efficient way to solve these problems is providing
harmonic compensation through parallel active power filters. Many
methods can be used in the control systems of the parallel active
power filters which provide the compensation. These methods
efficiently affect the performance of the active power filters. For this
reason, the chosen control method is significant. In this study, Fourier
analysis (FA) control method and synchronous reference frame (SRF)
control method are discussed. These control methods are designed for
both eliminate harmonics and perform reactive power compensation
in MATLAB/Simulink pack program and are tested. The results have
been compared for each two methods.