Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: There are several types of metal-based devices conceived as dampers for the seismic energy absorber whereby damages to the major structural components could be minimized for both new and existing structures. This paper aimed to develop and evaluate structural performance of slit circular shear panel damper for passive seismic energy protection by inelastic deformation. Structural evaluation was done using commercially available nonlinear FE simulation program. The main parameters considered are: diameter-to-thickness (D/t) ratio and slit length-to-width ratio (l/w). Depending on these parameters three different buckling mode and hysteretic behavior was found: yielding prior to buckling without strength degradation, yielding prior to buckling with strength degradation and yielding with buckling and strength degradation which forms pinching at initial displacement. The susceptible location at which the possible crack is initiated is also identified for selected specimens using rupture index.
Abstract: An investigation of adaptable winglets for morphing
aircraft control and performance is described in this paper. The
concepts investigated consist of various winglet configurations
fundamentally centred on a baseline swept wing. The impetus for the
work was to identify and optimize winglets to enhance controllability
and the aerodynamic efficiency of a small unmanned aerial vehicle.
All computations were performed with Athena Vortex Lattice
modelling with varying degrees of twist, swept, and dihedral angle
considered. The results from this work indicate that if adaptable
winglets were employed on small scale UAV’s improvements in both
aircraft control and performance could be achieved.
Abstract: A Jet-stream airsail concept takes advantage of aerology
in order to fly without propulsion. Weather phenomena, especially jet
streams, are relatively permanent high winds blowing from west to
east, located at average altitudes and latitudes in both hemispheres.
To continuously extract energy from the jet-stream, the system is
composed of a propelled plane and a wind turbine interconnected by
a cable. This work presents the aerodynamic characteristics and the
behavior of the cable that links the two subsystems and transmits
energy from the turbine to the aircraft. Two ways of solving this
problem are explored: numerically and analytically. After obtaining
the optimal shape of the cross-section of the cable, its behavior
is analyzed as a 2D problem solved numerically and analytically.
Finally, a 3D extension could be considered by adding lateral forces.
The results of this work can be further used in the design process of
the overall system: aircraft-turbine.
Abstract: Small and medium-sized enterprises (SME) are the backbone of central Europe’s economies and have a significant contribution to the gross domestic product. Production planning and scheduling (PPS) is still a crucial element in manufacturing industries of the 21st century even though this area of research is more than a century old. The topic of PPS is well researched especially in the context of large enterprises in the manufacturing industry. However the implementation of PPS methodologies within SME is mostly unobserved. This work analyzes how PPS is implemented in SME with the geographical focus on Switzerland and its vicinity. Based on restricted resources compared to large enterprises, SME have to face different challenges. The real problem areas of selected enterprises in regards of PPS are identified and evaluated. For the identified real-life problem areas of SME clear and detailed recommendations are created, covering concepts and best practices and the efficient usage of PPS. Furthermore the economic and entrepreneurial value for companies is lined out and why the implementation of the introduced recommendations is advised.
Abstract: This research presents the design, fabrication and application of a flavor sensor for an integrated electronic tongue and electronic nose that can allow rapid characterization of multi-component mixtures in a solution. The odor gas and liquid are separated using hydrophobic porous membrane in micro fluidic channel. The sensor uses an array composed of microbeads in micromachined cavities localized on silicon wafer. Sensing occurs via colorimetric and fluorescence changes to receptors and indicator molecules that are attached to termination sites on the polymeric microbeads. As a result, the sensor array system enables simultaneous and near-real-time analyses using small samples and reagent volumes with the capacity to incorporate significant redundancies. One of the key parts of the system is a passive pump driven only by capillary force. The hydrophilic surface of the fluidic structure draws the sample into the sensor array without any moving mechanical parts. Since there is no moving mechanical component in the structure, the size of the fluidic structure can be compact and the fabrication becomes simple when compared to the device including active microfluidic components. These factors should make the proposed system inexpensive to mass-produce, portable and compatible with biomedical applications.
Abstract: In recent years, the introduction of Pre Engineered Building (PEB) concept in the design of structures has helped in optimizing design. The adoptability of PEB in the place of Conventional Steel Building (CSB) design concept resulted in many advantages, including economy and easier fabrication. In this study, an industrial structure (Ware House) is analyzed and designed according to the Indian standards, IS 800-1984, IS 800-2007 and also by referring MBMA-96 and AISC-89. In this study, a structure with length 187m,width 40m,with clear height 8m and having R-Slope 1:10,isconsidered to carry out analysis& design for 2D frames (End frame, frame without crane and frame with 3 module cranes). The economy of the structure is discussed in terms of its weight comparison, between Indian codes (IS800-1984, IS800-2007) & American code (MBMA-96), & between Indian codes (IS800-1984, IS800-2007).
Abstract: In recent years, the adoption of mobile phones has been exceptionally rapid in many parts of the world, and Tanzania is not exceptional. We are witnessing a number of new mobile network operators being licensed from time to time by Tanzania Communications Regulatory Authority (TCRA). This makes competition in the telecommunications market very stiff. All mobile phone companies are struggling to earn more new customers into their networks. This trend courses a stiff competition. The various measures are being taken by different companies including, lowering tariff, and introducing free short messages within and out of their networks, and free calls during off-peak periods. This paper is aimed at investigating the influence of tariffs on students’ mobile customers in selecting their mobile network operators. About seventy seven students from high learning institutions in Dodoma Municipality, Tanzania, participated in responding to the prepared questionnaires. The sought information was aimed at determining if tariffs influenced students into selection of their current mobile operators. The results indicate that tariffs were the major driving factor in selection of mobile operators. However, female mobile customers were found to be more easily attracted into subscribing to a mobile operator due to low tariffs, a bigger number of free short messages or discounted call charges than their fellow male customers.
Abstract: This paper presents a comparative study between two
neural network models namely General Regression Neural Network
(GRNN) and Back Propagation Neural Network (BPNN) are used
to estimate radial overcut produced during Electrical Discharge
Machining (EDM). Four input parameters have been employed:
discharge current (Ip), pulse on time (Ton), Duty fraction (Tau) and
discharge voltage (V). Recently, artificial intelligence techniques, as
it is emerged as an effective tool that could be used to replace
time consuming procedures in various scientific or engineering
applications, explicitly in prediction and estimation of the complex
and nonlinear process. The both networks are trained, and the
prediction results are tested with the unseen validation set of the
experiment and analysed. It is found that the performance of both the
networks are found to be in good agreement with average percentage
error less than 11% and the correlation coefficient obtained for the
validation data set for GRNN and BPNN is more than 91%. However,
it is much faster to train GRNN network than a BPNN and GRNN is
often more accurate than BPNN. GRNN requires more memory space
to store the model, GRNN features fast learning that does not require
an iterative procedure, and highly parallel structure. GRNN networks
are slower than multilayer perceptron networks at classifying new
cases.
Abstract: Negotiation is a specific form of interaction based on communication in which the parties enter into deliberately, each with clear but different interests or goals and a mutual dependency towards a decision due to be taken at the end of the confrontation. Consequently, negotiation is a complex activity involving many different disciplines from the strategic aspects and the decision making process to the evaluation of alternatives or outcomes and the exchange of information. While gender differences can be considered as one of the most researched topic within negotiation studies, empirical works and theory present many conflicting evidences and results about the role of gender in the process or the outcome. Furthermore, little interest has been shown over gender differences in the definition of what is negotiation, its essence or fundamental elements. Or, as differences exist in practices, it might be essential to study if the starting point of these discrepancies does not come from different considerations about what is negotiation and what will encourage the participants in their strategic decisions. Some recent and promising experiments made with diverse groups show that male and female participants in a common and shared situation barely consider the same way the concepts of power, trust or stakes which are largely considered as the usual driving forces of any negotiation. Furthermore, results from Human Resource self-assessment tests display and confirm considerable differences between individuals regarding essential behavioral dimensions like capacity to improvise and to achieve, aptitude to conciliate or to compete and orientation towards power and group domination which are also part of negotiation skills. Our intention in this paper is to confront these dimensions with negotiation’s usual driving forces in order to build up new paths for further research.
Abstract: The objective of this research was to study Brand
Position Communication Channel in Brand Building in Rajabhat
University Affecting Decision Making of Higher Education from of
qualitative research and in-depth interview with executive members
Rajabhat University and also quantitative by questionnaires which are
personal data of students, study of the acceptance and the finding of
the information of Rajabhat University, study of pattern or Brand
Position Communication Channel affecting the decision making of
studying in Rajabhat University and the result of the communication
in Brand Position Communication Channel. It is found that online
channel and word of mount are highly important and necessary for
education business since media channel is a tool and the management
of marketing communication to create brand awareness, brand
credibility and to achieve the high acclaim in terms of bringing out
qualified graduates. Also, off-line channel can enable the institution
to survive from the high competition especially in education business
regarding management of the Rajabhat University. Therefore,
Rajabhat University has to communicate by the various
communication channel strategies for brand building for attractive
student to make decision making of higher education.
Abstract: This paper describes a blind algorithm, which is
compared with two another algorithms proposed in the literature,
for estimating of the minimum phase channel parameters. In order to
identify blindly the impulse response of these channels, we have used
Higher Order Statistics (HOS) to build our algorithm. The simulation
results in noisy environment, demonstrate that the proposed method
could estimate the phase and magnitude with high accuracy of these
channels blindly and without any information about the input, except
that the input excitation is identically and independent distribute
(i.i.d) and non-Gaussian.
Abstract: Laser beam welding has wide acceptability due to least welding distortion, low labour costs and convenient operation. However, laser welding for dissimilar titanium and aluminium alloys is a new area which is having wider applications in aerospace, aircraft, automotive, electronics and other industries. The present study is concerned with welding parameters namely laser power, welding speed, focusing distance and type of shielding gas and thereby evaluate welding performance of titanium and aluminium alloy thin sheets. This paper reviews the basic concepts associated with different parameters of Ti/Al sheet joint using Laser beam welding.
Abstract: As widely accepted, didactic multiple-choice tests are referred as a tool providing feedback easily and quickly. Despite the final test scores are corrected by a special formula and number of high plausibility distractors is taken into consideration, the results may be influenced by the random choice. The survey was held in three academic years at the Faculty of Informatics and Management, University of Hradec Kralove, Czech Republic, where the multiple-choice test scores were compared to the open-answer ones. The research sample included 567 respondents. The collected data were processed by the NCSS2007 statistic software by the method of frequency and multiple regression analysis and presented in the form of figures and tables. The results proved statistically significant differences in test scores in academic years 2 and 3, and were discussed from the point of the credit system and conditions for teaching/learning English in the Czech education system.
Abstract: The purpose of this paper was to examine views of
secondary school science teachers about purposes to use practical
works in school science. The instrument to survey consisted eighteen
items, which were categorized into four components as follows:
‘Scientific inquiry’, ‘Scientific knowledge’, ‘Science-related attitude’,
and ‘STS (science-technology-society)’. Subjects were 152 secondary
school science teachers (male 70 and female 82; middle school 50 and
high school 102), who are teaching in 42 schools of 8 provinces. On
the survey, science teachers were asked to answer on 5-point Lickert
scale (from 1 to 5) how they thought of using practical works on
purposes with domains of science objectives in school. They had
positive views about using practical works for improving scientific
inquiry process skills, science-related attitudes, and perceptions about
STS literacy, and acquiring scientific knowledge. They would have the
most willingness of using practical works for ‘Scientific Inquiry’
among domains of science objectives in school.
Abstract: Recent growth in digital multimedia technologies has presented a lot of facilities in information transmission, reproduction and manipulation. Therefore, the concept of information security is one of the superior articles in the present day situation. The biometric information security is one of the information security mechanisms. It has the advantages as well as disadvantages. The biometric system is at risk to a range of attacks. These attacks are anticipated to bypass the security system or to suspend the normal functioning. Various hazards have been discovered while using biometric system. Proper use of steganography greatly reduces the risks in biometric systems from the hackers. Steganography is one of the fashionable information hiding technique. The goal of steganography is to hide information inside a cover medium like text, image, audio, video etc. through which it is not possible to detect the existence of the secret information. Here in this paper a new security concept has been established by making the system more secure with the help of steganography along with biometric security. Here the biometric information has been embedded to a skin tone portion of an image with the help of proposed steganographic technique.
Abstract: Although urbanization in Africa has been characterized by fragile socio-economic successes, the sustainability of city infrastructure is now central to planning processes as a pathway to closing the deficit in terms of coverage and access. This paper builds on survey and interview data from Kampala city, to demonstrate how the principle gender responsiveness can inform improvements in urban infrastructure and service delivery. We discovered that women prefer infrastructure that combines living and working spaces for reduced labour and travel burdens between homes, markets, schools, and other urban spaces. Men’s conception of infrastructure needs on the other hand, mirrored public security and connectivity concerns along city streets and work places. However, the urban planning approach at city-level is guided by mainstream engineering and architectural designs that do not necessarily reflect the social context within which urban infrastructure influences gender roles and the attendant mobility needs. To address the challenge across cities of similar context, the paper concludes with a set of analytic steps on how the gendered influences on infrastructure-use can be considered in urban planning cycles.
Abstract: Local utilities often face problems of local industrial
wastes, storm water disposal due to existing strict regulations. For
many local industries, the problem of wastewater treatment and
discharge into surface reservoirs can’t be solved through the use of
conventional biological treatment techniques. Current discharge
standards require very strict removal of a number of impurities such
as ammonia, nitrates, phosphate, etc. To reach this level of removal,
expensive reagents and sorbents are used.
The modern concept of rational water resources management
requires the development of new efficient techniques that provide
wastewater treatment and reuse.
As RO membranes simultaneously reject all dissolved impurities
such as BOD, TDS, ammonia, phosphates etc., they become very
attractive for the direct treatment of wastewater without biological
stage. To treat wastewater, specially designed membrane "open
channel" modules are used that do not possess "dead areas" that cause
fouling or require pretreatment. A solution to RO concentrate
disposal problem is presented that consists of reducing of initial
wastewater volume by 100 times. Concentrate is withdrawn from
membrane unit as sludge moisture. The efficient use of membrane
RO techniques is connected with a salt balance in water system.
Thus, to provide high ecological efficiency of developed techniques,
all components of water supply and wastewater discharge systems
should be accounted for.
Abstract: This research paper is aimed to examine a relationship between the service marketing mix and customers’ frequency of use of service at Mercedes Benz Auto Repair Centres under Thonburi Group, Thailand. Based on 2,267 customers who used the service of Thonburi Group’s Auto Repair Centres as the population, the sampling of this research was a total of 340 samples, by use of Probability Sampling Technique. Systematic Random Sampling was applied by use of questionnaire in collecting the data at Thonburi Group’s Auto Repair Centres. Mean and Pearson’s basic statistical correlations were utilized in analyzing the data. The study discovered a medium level of customers’ perception towards product and service of Thonburi Group’s Auto Repair Centres, price, place or distribution channel and promotion. People who provided service were perceived also at a medium level, whereas the physical evidence and service process were perceived at a high level. Furthermore, there appeared a correlation between the physical evidence and service process, and customers’ frequency of use of automobile service per year.