Abstract: Spintronic, also termed spin electronics or spin transport electronics, is a kind of new technology, which exploits the two fundamental degrees of freedom- spin-state and charge-state of electrons to enhance the operational speed for the data storage and transfer efficiency of the device. Thus, it seems an encouraging technology to combat most of the prevailing complications in orthodox electron-based devices. This novel technology possesses the capacity to mix the semiconductor microelectronics and magnetic devices’ functionalities into one integrated circuit. Traditional semiconductor microelectronic devices use only the electronic charge to process the information based on binary numbers, 0 and 1. Due to the incessant shrinking of the transistor size, we are reaching the final limit of 1 nm or so. At this stage, the fabrication and other device operational processes will become challenging as the quantum effect comes into play. In this situation, we should find an alternative future technology, and spintronic may be such technology to transfer and store information. This review article provides a detailed discussion of the spintronic technology: fundamentals, materials, devices, circuits, challenges, and current research trends. At first, the fundamentals of spintronics technology are discussed. Then types, properties, and other issues of the spintronic materials are presented. After that, fabrication and working principles, as well as application areas and advantages/disadvantages of spintronic devices and circuits, are explained. Finally, the current challenges, current research areas, and prospects of spintronic technology are highlighted. This is a new paradigm of electronic cum magnetic devices built on the charge and spin of the electrons. Modern engineering and technological advances in search of new materials for this technology give us hope that this would be a very optimistic technology in the upcoming days.
Abstract: Wilson’s disease (WD) is an autosomal recessive disorder of the copper metabolism, which is caused by a mutation in the copper-transporting P-type ATPase (ATP7B). The mechanism of this disease is the failure of hepatic excretion of copper to bile, and leads to copper deposits in the liver and other organs. The ATP7B gene is located on the long arm of chromosome 13 (13q14.3). This study aimed to investigate the gene mutation in the Vietnamese patients with WD, and make a presymptomatic diagnosis for their familial members. Forty-three WD patients and their 65 siblings were identified as having ATP7B gene mutations. Genomic DNA was extracted from peripheral blood samples; 21 exons and exon-intron boundaries of the ATP7B gene were analyzed by direct sequencing. We recognized four mutations ([R723=; H724Tfs*34], V1042Cfs*79, D1027H, and IVS6+3A>G) in the sum of 20 detectable mutations, accounting for 87.2% of the total. Mutation S105* was determined to have a high rate (32.6%) in this study. The hotspot regions of ATP7B were found at exons 2, 16, and 8, and intron 14, in 39.6 %, 11.6 %, 9.3%, and 7 % of patients, respectively. Among nine homozygote/compound heterozygote siblings of the patients with WD, three individuals were determined as asymptomatic by screening mutations of the probands. They would begin treatment after diagnosis. In conclusion, 20 different mutations were detected in 43 WD patients. Of this number, four novel mutations were explored, including [R723=; H724Tfs*34], V1042Cfs*79, D1027H, and IVS6+3A>G. The mutation S105* is the most prevalent and has been considered as a biomarker that can be used in a rapid detection assay for diagnosis of WD patients. Exons 2, 8, and 16, and intron 14 should be screened initially for WD patients in Vietnam. Based on risk profile for WD, genetic testing for presymptomatic patients is also useful in diagnosis and treatment.
Abstract: The capability of exploiting the electronic charge and
spin properties simultaneously in a single material has made diluted
magnetic semiconductors (DMS) remarkable in the field of
spintronics. We report the designing of DMS based on zinc-blend
ZnO doped with Cr impurity. The full potential linearized augmented
plane wave plus local orbital FP-L(APW+lo) method in density
functional theory (DFT) has been adapted to carry out these
investigations. For treatment of exchange and correlation energy,
generalized gradient approximations have been used. Introducing Cr
atoms in the matrix of ZnO has induced strong magnetic moment
with ferromagnetic ordering at stable ground state. Cr:ZnO was found
to favor the short range magnetic interaction that
reflect tendency of Cr clustering. The electronic structure of ZnO is
strongly influenced in the presence of Cr impurity atoms where
impurity bands appear in the band gap.
Abstract: Using the first-principles full-potential linearized
augmented plane wave plus local orbital (FP-LAPW+lo) method
based on density functional theory (DFT), we have investigated the
electronic structure and magnetism of full Heusler alloys Co2ZrGe
and Co2NbB. These compounds are predicted to be half-metallic
ferromagnets (HMFs) with a total magnetic moment of 2.000 B per
formula unit, well consistent with the Slater-Pauling rule.
Calculations show that both the alloys have an indirect band gaps, in
the minority-spin channel of density of states (DOS), with values of
0.58 eV and 0.47 eV for Co2ZrGe and Co2NbB, respectively.
Analysis of the DOS and magnetic moments indicates that their
magnetism is mainly related to the d-d hybridization between the Co
and Zr (or Nb) atoms. The half-metallicity is found to be relatively
robust against volume changes. In addition, an atom inside molecule
AIM formalism and an electron localization function ELF were also
adopted to study the bonding properties of these compounds, building
a bridge between their electronic and bonding behavior.
As they have a good crystallographic compatibility with the lattice of
semiconductors used industrially and negative calculated cohesive
energies with considerable absolute values these two alloys could be
promising magnetic materials in the spintronic field.
Abstract: One- and two-dimensional carbon nanostructures with
sp2 hybridization of carbon atoms (single walled carbon nanotubes
and graphene) are promising materials in future electronic and
spintronics devices due to specific character of their electronic
structure. In this paper we present a comparative study of graphene
and single-wall carbon nanotubes by Raman spectro-microscopy in
strong magnetic field. This unique method allows to study changes in
electronic band structure of the two types of carbon nanostructures
induced by a strong magnetic field.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The MyD88 is an evolutionarily conserved host-expressed adaptor protein that is essential for proper TLR/ IL1R immune-response signaling. A previously identified complete cDNA (1626 bp) of OfMyD88 comprised an ORF of 867 bp encoding a protein of 288 amino acids (32.9 kDa). The gDNA (3761 bp) of OfMyD88 revealed a quinquepartite genome organization composed of 5 exons (with the sizes of 310, 132, 178, 92 and 155 bp) separated by 4 introns. All the introns displayed splice signals consistent with the consensus GT/AG rule. A bipartite domain structure with two domains namely death domain (24-103) coded by 1st exon, and TIR domain (151-288) coded by last 3 exons were identified through in silico analysis. Moreover, homology modeling of these two domains revealed a similar quaternary folding nature between human and rock bream homologs. A comprehensive comparison of vertebrate MyD88 genes showed that they possess a 5-exonic structure.In this structure, the last three exons were strongly conserved, and this suggests that a rigid structure has been maintained during vertebrate evolution.A cluster of TATA box-like sequences were found 0.25 kb upstream of cDNA starting position. In addition, putative 5'-flanking region of OfMyD88 was predicted to have TFBS implicated with TLR signaling, including copies of NFkB1, APRF/ STAT3, Sp1, IRF1 and 2 and Stat1/2. Using qPCR technique, a ubiquitous mRNA expression was detected in liver and blood. Furthermore, a significantly up-regulated transcriptional expression of OfMyD88 was detected in head kidney (12-24 h; >2-fold), spleen (6 h; 1.5-fold), liver (3 h; 1.9-fold) and intestine (24 h; ~2-fold) post-Fla challenge. These data suggest a crucial role for MyD88 in antibacterial immunity of teleosts.
Abstract: Drought stress is a critical environmental factor that adversely affects crop productivity and quality. Because of their immobile nature, plants have evolved mechanisms to sense and respond to drought stress. We identified a novel locus of Arabidopsis, designated DRA1 (drought responsive ankyrin1), whose disruption leads to increased drought-stress tolerance. DRA1 encodes a transmembrane protein with an ankyrin-repeat motif that has been implicated in diverse cellular processes such as signal transduction. RT-PCR analysis revealed that there were at least two splicing variants of DRA1 transcripts in wild-type plants. In response to drought stress, the levels of DRA1 transcripts retaining second and third introns were increased, whereas these introns were removed under unstressed conditions. These results suggest that DRA1 protein may negatively regulate plant drought tolerance and that the expression of DRA1is regulated in response to drought stress by alternative splicing.
Abstract: Drought stress is a critical environmental factor that adversely affects crop productivity and quality. Because of their immobile nature, plants have evolved mechanisms to sense and respond to drought stress. We identified a novel locus of Arabidopsis, designated DRA1 (drought responsive ankyrin1), whose disruption leads to increased drought-stress tolerance. DRA1 encodes a transmembrane protein with an ankyrin-repeat motif that has been implicated in diverse cellular processes such as signal transduction. RT-PCR analysis revealed that there were at least two splicing variants of DRA1 transcripts in wild-type plants. In response to drought stress, the levels of DRA1 transcripts retaining second and third introns were increased, whereas these introns were removed under unstressed conditions. These results suggest that DRA1 protein may negatively regulate plant drought tolerance and that the expression of DRA1is regulated in response to drought stress by alternative splicing.
Abstract: A major goal in animal genetics is to understand the role of common genetic variants in diseases susceptibility and production traits. Sahiwal cattle can be considered as a global animal genetic resource due to its relatively high milk producing ability, resistance against tropical diseases and heat tolerant. CYP11B1 gene provides instructions for making a mitochondrial enzyme called steroid 11-beta-hydroxylase. It catalyzes the 11deoxy-cortisol to cortisol and 11deoxycorticosterone to corticosterone in cattle. The bovine CYP11B1 gene is positioned on BTA14q12 comprises of eight introns and nine exons and protein is associated with mitochondrial epithelium. The present study was aimed to identify the single-nucleotide polymorphisms in CYP11B1 gene in Sahiwal cattle breed of Pakistan. Four polymorphic sites were identified in exon one of CYP11B1 gene through sequencing approach. Significant finding was the incidence of the C→T polymorphism in 5'-UTR, causing amino acid substitution from alanine to valine (A30V) in Sahiwal cattle breed. That Ala/Val polymorphism may serve as a powerful genetic tool for the development of DNA markers that can be used for the particular traits for different local cattle breeds.
Abstract: MiRNAs participate in gene regulation of translation.
Some studies have investigated the interactions between genes and
intragenic miRNAs. It is important to study the miRNA binding sites
of genes involved in carcinogenesis. RNAHybrid 2.1 and ERNAhybrid
programmes were used to compute the hybridization free
energy of miRNA binding sites. Of these 54 mRNAs, 22.6%, 37.7%,
and 39.7% of miRNA binding sites were present in the 5'UTRs,
CDSs, and 3'UTRs, respectively. The density of the binding sites for
miRNAs in the 5'UTR ranged from 1.6 to 43.2 times and from 1.8 to
8.0 times greater than in the CDS and 3'UTR, respectively. Three
types of miRNA interactions with mRNAs have been revealed: 5'-
dominant canonical, 3'-compensatory, and complementary binding
sites. MiRNAs regulate gene expression, and information on the
interactions between miRNAs and mRNAs could be useful in
molecular medicine. We recommend that newly described sites
undergo validation by experimental investigation.
Abstract: For identifying the discriminative sequence features between exons and introns, a new paradigm, rescaled-range frameshift analysis (RRFA), was proposed. By RRFA, two new
sequence features, the frameshift sensitivity (FS) and the accumulative
penta-mer complexity (APC), were discovered which
were further integrated into a new feature of larger scale, the persistency in anti-mutation (PAM). The feature-validation experiments
were performed on six model organisms to test the power
of discrimination. All the experimental results highly support that FS, APC and PAM were all distinguishing features between exons
and introns. These identified new sequence features provide new insights into the sequence composition of genes and they have
great potentials of forming a new basis for recognizing the exonintron boundaries in gene sequences.
Abstract: MRAM technology provides a combination of fast
access time, non-volatility, data retention and endurance. While a
growing interest is given to two-terminal Magnetic Tunnel Junctions
(MTJ) based on Spin-Transfer Torque (STT) switching as the
potential candidate for a universal memory, its reliability is
dramatically decreased because of the common writing/reading path.
Three-terminal MTJ based on Spin-Orbit Torque (SOT) approach
revitalizes the hope of an ideal MRAM. It can overcome the
reliability barrier encountered in current two-terminal MTJs by
separating the reading and the writing path. In this paper, we study
two possible writing schemes for the SOT-MTJ device based on
recently fabricated samples. While the first is based on precessional
switching, the second requires the presence of permanent magnetic
field. Based on an accurate Verilog-A model, we simulate the two
writing techniques and we highlight advantages and drawbacks of
each one. Using the second technique, pioneering logic circuits based
on the three-terminal architecture of the SOT-MTJ described in this
work are under development with preliminary attractive results.
Abstract: Many digital signal processing, techniques have been used to automatically distinguish protein coding regions (exons) from non-coding regions (introns) in DNA sequences. In this work, we have characterized these sequences according to their nonlinear dynamical features such as moment invariants, correlation dimension, and largest Lyapunov exponent estimates. We have applied our model to a number of real sequences encoded into a time series using EIIP sequence indicators. In order to discriminate between coding and non coding DNA regions, the phase space trajectory was first reconstructed for coding and non-coding regions. Nonlinear dynamical features are extracted from those regions and used to investigate a difference between them. Our results indicate that the nonlinear dynamical characteristics have yielded significant differences between coding (CR) and non-coding regions (NCR) in DNA sequences. Finally, the classifier is tested on real genes where coding and non-coding regions are well known.
Abstract: Gene, principal unit of inheritance, is an ordered
sequence of nucleotides. The genes of eukaryotic organisms include
alternating segments of exons and introns. The region of
Deoxyribonucleic acid (DNA) within a gene containing instructions
for coding a protein is called exon. On the other hand, non-coding
regions called introns are another part of DNA that regulates gene
expression by removing from the messenger Ribonucleic acid (RNA)
in a splicing process. This paper proposes to determine splice
junctions that are exon-intron boundaries by analyzing DNA
sequences. A splice junction can be either exon-intron (EI) or intron
exon (IE). Because of the popularity and compatibility of the
artificial neural network (ANN) in genetic fields; various ANN
models are applied in this research. Multi-layer Perceptron (MLP),
Radial Basis Function (RBF) and Generalized Regression Neural
Networks (GRNN) are used to analyze and detect the splice junctions
of gene sequences. 10-fold cross validation is used to demonstrate
the accuracy of networks. The real performances of these networks
are found by applying Receiver Operating Characteristic (ROC)
analysis.
Abstract: In the paper, the relative performances on spectral
classification of short exon and intron sequences of the human and
eleven model organisms is studied. In the simulations, all
combinations of sixteen one-sequence numerical representations, four
threshold values, and four window lengths are considered. Sequences
of 150-base length are chosen and for each organism, a total of
16,000 sequences are used for training and testing. Results indicate
that an appropriate combination of one-sequence numerical
representation, threshold value, and window length is essential for
arriving at top spectral classification results. For fixed-length
sequences, the precisions on exon and intron classification obtained
for different organisms are not the same because of their genomic
differences. In general, precision increases as sequence length
increases.
Abstract: Eukaryotic protein-coding genes are interrupted by spliceosomal introns, which are removed from the RNA transcripts before translation into a protein. The exon-intron structures of different eukaryotic species are quite different from each other, and the evolution of such structures raises many questions. We try to address some of these questions using statistical analysis of whole genomes. We go through all the protein-coding genes in a genome and study correlations between the net length of all the exons in a gene, the number of the exons, and the average length of an exon. We also take average values of these features for each chromosome and study correlations between those averages on the chromosomal level. Our data show universal features of exon-intron structures common to animals, plants, and protists (specifically, Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, Cryptococcus neoformans, Homo sapiens, Mus musculus, Oryza sativa, and Plasmodium falciparum). We have verified linear correlation between the number of exons in a gene and the length of a protein coded by the gene, while the protein length increases in proportion to the number of exons. On the other hand, the average length of an exon always decreases with the number of exons. Finally, chromosome clustering based on average chromosome properties and parameters of linear regression between the number of exons in a gene and the net length of those exons demonstrates that these average chromosome properties are genome-specific features.
Abstract: The full length mitochondrial small subunit ribosomal
(mt-rns) gene has been characterized for Ophiostoma novo-ulmi
subspecies americana. The gene was also characterized for
Ophiostoma ulmi and a group II intron was noted in the mt-rns gene
of O. ulmi. The insertion in the mt-rns gene is at position S952 and it
is a group IIB1 intron that encodes a double motif LAGLIDADG
homing endonuclease from an open reading frame located within a
loop of domain III. Secondary structure models for the mt-rns RNA
of O. novo-ulmi subsp. americana and O. ulmi were generated to
place the intron within the context of the ribosomal RNA. The in vivo
splicing of the O.ul-mS952 group II intron was confirmed with
reverse transcription-PCR. A survey of 182 strains of Dutch Elm
Diseases causing agents showed that the mS952 intron was absent in
what is considered to be the more aggressive species O. novo-ulmi
but present in strains of the less aggressive O. ulmi. This observation
suggests that the O.ul-mS952 intron can be used as a PCR-based
molecular marker to discriminate between O. ulmi and O. novo-ulmi
subsp. americana.
Abstract: Tumour suppressors are key participants in the
prevention of cancer. Regulation of their expression through
miRNAs is important for comprehensive translation inhibition of
tumour suppressors and elucidation of carcinogenesis mechanisms.
We studies the possibility of 1521 miRNAs to bind with 873 mRNAs
of human tumour suppressors using RNAHybrid 2.1 and ERNAhybrid
programmes. Only 978 miRNAs were found to be
translational regulators of 812 mRNAs, and 61 mRNAs did not have
any miRNA binding sites. Additionally, 45.9% of all miRNA binding
sites were located in coding sequences (CDSs), 33.8% were located
in 3' untranslated region (UTR), and 20.3% were located in the
5'UTR. MiRNAs binding with more than 50 target mRNAs and
mRNAs binding with several miRNAs were selected. Hsa-miR-5096
had 15 perfectly complementary binding sites with mRNAs of 14
tumour suppressors. These newly indentified miRNA binding sites
can be used in the development of medicines (anti-sense therapies)
for cancer treatment.
Abstract: Regulatory relationships of 686 intronic miRNA and 784 intergenic miRNAs with mRNAs of 51 intronic miRNA coding genes were established. Interaction features of studied miRNAs with 5'UTR, CDS and 3'UTR of mRNA of each gene were revealed. Functional regions of mRNA were shown to be significantly heterogenous according to the number of binding sites of miRNA and to the location density of these sites.