Top Journal

International Journal of Architectural, Civil and Construction Sciences International Journal of Biological, Life and Agricultural Sciences International Journal of Chemical, Materials and Biomolecular Sciences International Journal of Business, Human and Social Sciences International Journal of Earth, Energy and Environmental Sciences International Journal of Electrical, Electronic and Communication Sciences International Journal of Engineering, Mathematical and Physical Sciences International Journal of Medical, Medicine and Health Sciences International Journal of Mechanical, Industrial and Aerospace Sciences International Journal of Information, Control and Computer Sciences

SUGGEST A JOURNAL

Join Scholarly today, and help us improve Open Access Journal database.

+ Sign Up

Advanced Search

Analysis of OPG Gene Polymorphism T245G (rs3134069) in Slovak Postmenopausal Women

Year: 2014 Volume: 8 Issue: 9 618 - 621 Pages

Abstract: Osteoporosis is a common multifactorial disease with a strong genetic component characterized by reduced bone mass and increased risk of fractures. Genetic factors play an important role in the pathogenesis of osteoporosis. The aim of our study was to identify the genotype and allele distribution of T245G polymorphism in OPG gene in Slovak postmenopausal women. A total of 200 unrelated Slovak postmenopausal women with diagnosed osteoporosis and 200 normal controls were genotyped for T245G (rs3134069) polymorphism of OPG gene. Genotyping was performed using the Custom Taqman®SNP Genotyping assays. Genotypes and alleles frequencies showed no significant differences (p=0.5551; p=0.6022). The results of the present study confirm the importance of T245G polymorphism in OPG gene in the pathogenesis of osteoporosis.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Year: 2014 Volume: 8 Issue: 7 765 - 771 Pages

Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

RAPD Analysis of the Genetic Polymorphism in the Collection of Rye Cultivars

Year: 2014 Volume: 8 Issue: 7 689 - 693 Pages

Abstract: In the present study, RAPD-PCR was used to assess genetic diversity of the rye including landrances and new rye cultivars coming from Central Europe and the Union of Soviet Socialist Republics (SUN). Five arbitrary random primers were used to determine RAPD polymorphism in the set of 38 rye genotypes. These primers amplified altogether 43 different DNA fragments with an average number of 8.6 fragments per genotypes. The number of fragments ranged from 7 (RLZ 8, RLZ 9 and RLZ 10) to 12 (RLZ 6). DI and PIC values of all RAPD markers were higher than 0.8 that generally means high level of polymorphism detected between rye genotypes. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared. The cultivars were grouped into two main clusters. In this experiment, RAPD proved to be a rapid, reliable and practicable method for revealing of polymorphism in the rye cultivars.

Transcriptional Evidence for the Involvement of MyD88 in Flagellin Recognition: Genomic Identification of Rock Bream MyD88 and Comparative Analysis

Year: 2014 Volume: 8 Issue: 5 516 - 519 Pages

Abstract: The MyD88 is an evolutionarily conserved host-expressed adaptor protein that is essential for proper TLR/ IL1R immune-response signaling. A previously identified complete cDNA (1626 bp) of OfMyD88 comprised an ORF of 867 bp encoding a protein of 288 amino acids (32.9 kDa). The gDNA (3761 bp) of OfMyD88 revealed a quinquepartite genome organization composed of 5 exons (with the sizes of 310, 132, 178, 92 and 155 bp) separated by 4 introns. All the introns displayed splice signals consistent with the consensus GT/AG rule. A bipartite domain structure with two domains namely death domain (24-103) coded by 1st exon, and TIR domain (151-288) coded by last 3 exons were identified through in silico analysis. Moreover, homology modeling of these two domains revealed a similar quaternary folding nature between human and rock bream homologs. A comprehensive comparison of vertebrate MyD88 genes showed that they possess a 5-exonic structure.In this structure, the last three exons were strongly conserved, and this suggests that a rigid structure has been maintained during vertebrate evolution.A cluster of TATA box-like sequences were found 0.25 kb upstream of cDNA starting position. In addition, putative 5'-flanking region of OfMyD88 was predicted to have TFBS implicated with TLR signaling, including copies of NFkB1, APRF/ STAT3, Sp1, IRF1 and 2 and Stat1/2. Using qPCR technique, a ubiquitous mRNA expression was detected in liver and blood. Furthermore, a significantly up-regulated transcriptional expression of OfMyD88 was detected in head kidney (12-24 h; >2-fold), spleen (6 h; 1.5-fold), liver (3 h; 1.9-fold) and intestine (24 h; ~2-fold) post-Fla challenge. These data suggest a crucial role for MyD88 in antibacterial immunity of teleosts.

Phenotypical and Genotypical Assessment Techniques for Identification of Some Contagious Mastitis Pathogens

Year: 2014 Volume: 8 Issue: 5 245 - 251 Pages

Abstract: Mastitis is one of the most economic disease affecting dairy cows worldwide. Its classic diagnosis using bacterial culture and biochemical findings is a difficult and prolonged method. In this research, using of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) permitted identification of different microorganisms with high accuracy and rapidity (only 24 hours for microbial growth and analysis). During the application of MALDI-TOF MS, one hundred twenty strains of Staphylococcus and Streptococcus species isolated from milk of cows affected by clinical and subclinical mastitis were identified, and the results were compared with those obtained by traditional methods as API and VITEK 2 Systems. 37 of totality 39 strains (~95%) of Staphylococcus aureus (S. aureus) were exactly detected by MALDI TOF MS and then confirmed by a nuc-based PCR technique, whereas accurate identification was observed in 100% (50 isolates) of the coagulase negative staphylococci (CNS) and Streptococcus agalactiae (31 isolates). In brief, our results demonstrated that MALDI-TOF MS is a fast and truthful technique which has the capability to replace conventional identification of several bacterial strains usually isolated in clinical laboratories of microbiology.

Alternative Splicingof an Arabidopsis Gene, At2g24600, Encoding Ankyrin-Repeat Protein

Year: 2014 Volume: 8 Issue: 3 211 - 213 Pages

Abstract: In Arabidopsis, several genes encoding proteins with ankyrin repeats and transmembrane domains (AtANKTM) have been identified as mediators of biotic and abiotic stress responses. It has been known that the expression of an AtANKTM gene, At2g24600, is induced in response to abiotic stress and that there are four splicing variants derived from this locus. In this study, by RT-PCR and sequencing analysis, an unknown splicing variant of the At2g24600 transcript was identified. Based on differences in the predicted amino acid sequences, the five splicing variants are divided into three groups. The three predicted proteins are highly homologous, yet have different numbers of ankyrinrepeats and transmembrane domains. It is generally considered that ankyrin repeats mediate protein-protein interaction and that the number oftransmembrane domains affects membrane topology of proteins. The protein variants derived from the At2g24600 locus may have different molecular functions each other.

Implication and Genetic Variations on Lipid Profile of the Fasting Respondent

Year: 2013 Volume: 7 Issue: 6 329 - 331 Pages

Abstract: PPARs function as regulators of lipid and lipoprotein metabolism. The aim of the study was to compare the lipid profile between two phases of fasting and to examine the frequency and relationship of peroxisome proliferator-activated receptor, PPARα gene polymorphisms to lipid profile in fasting respondents. We conducted a case-control study protocol, which included 21 healthy volunteers without gender discrimination at the age of 18 years old. 3 ml of blood sample was drawn before the fasting phase and during the fasting phase (in Ramadhan month). 1ml of serum for the lipid profile was analyzed by using the automated chemistry analyser (Olympus, AU 400) and the data were analysed using the Paired T-Test (SPSS ver.20). DNA was extracted and PCR was conducted utilising 6 sets of primer. Primers were designed within 6 exons of interest in PPARα gene. Genetic and metabolic characteristics of fasting respondents and controls were estimated and compared. Fasting respondents were significantly have lowered the LDL levels (p=0.03). There were no polymorphisms detected except in exon 1 with 5% of this population study respectively. The polymorphisms in exon 1 of the PPARα gene were found in low frequency. Regarding the 1375G/T and 1386G/T polymorphisms in the exon 1 of the PPARα gene, the T-allele in fasting phase had no association with the decreased LDL levels (Fisher Exact Test). However this association is more promising when the sample size is larger in order to elucidate the precise impact of the polymorphisms on lipid profile in the population. In conclusion, the PPARα gene polymorphisms do not appear to affect the LDL of fasting respondents.

A Novel Method for Non-Invasive Diagnosis of Hepatitis C Virus Using Electromagnetic Signal Detection: A Multicenter International Study

Year: 2013 Volume: 7 Issue: 12 997 - 1003 Pages

Abstract: A simple, rapid and non-invasive electromagnetic sensor (C-FAST device) was- patented; for diagnosis of HCV RNA. Aim: To test the validity of the device compared to standard HCV PCR. Subjects and Methods: The first phase was done as pilot in Egypt on 79 participants; the second phase was done in five centers: one center from Egypt, two centers from Pakistan and two centers from India (800, 92 and 113 subjects respectively). The third phase was done nationally as multicenter study on (1600) participants for ensuring its representativeness. Results: When compared to PCR technique, C-FAST device revealed sensitivity 95% to 100%, specificity 95.5% to 100%, PPV 89.5% to 100%, NPV 95% to 100% and positive likelihood ratios 21.8% to 38.5%. Conclusion: It is practical evidence that HCV nucleotides emit electromagnetic signals that can be used for its identification. As compared to PCR, C-FAST is an accurate, valid and non-invasive device.

TNFRSF11B Gene Polymorphisms A163G and G11811C in Prediction of Osteoporosis Risk

Year: 2014 Volume: 8 Issue: 1 30 - 32 Pages

Abstract: Osteoporosis is a complex health disease characterized by low bone mineral density, which is determined by an interaction of genetics with metabolic and environmental factors. Current research in genetics of osteoporosis is focused on identification of responsible genes and polymorphisms. TNFRSF11B gene plays a key role in bone remodeling. The aim of this study was to investigate the genotype and allele distribution of A163G (rs3102735) osteoprotegerin gene promoter and G1181C (rs2073618) osteoprotegerin first exon polymorphisms in the group of 180 unrelated postmenopausal women with diagnosed osteoporosis and 180 normal controls. Genomic DNA was isolated from peripheral blood leukocytes using standard methodology. Genotyping for presence of different polymorphisms was performed using the Custom Taqman®SNP Genotyping assays. Hardy-Weinberg equilibrium was tested for each SNP in the groups of participants using the chi-square (χ2) test. The distribution of investigated genotypes in the group of patients with osteoporosis were as follows: AA (66.7%), AG (32.2%), GG (1.1%) for A163G polymorphism; GG (19.4%), CG (44.4%), CC (36.1%) for G1181C polymorphism. The distribution of genotypes in normal controls were follows: AA (71.1%), AG (26.1%), GG (2.8%) for A163G polymorphism; GG (22.2%), CG (48.9%), CC (28.9%) for G1181C polymorphism. In A163G polymorphism the variant G allele was more common among patients with osteoporosis: 17.2% versus 15.8% in normal controls. Also, in G1181C polymorphism the phenomenon of more frequent occurrence of C allele in the group of patients with osteoporosis was observed (58.3% versus 53.3%). Genotype and allele distributions showed no significant differences (A163G: χ2=0.270, p=0.605; χ2=0.250, p=0.616; G1181C: χ2= 1.730, p=0.188; χ2=1.820, p=0.177). Our results represents an initial study, further studies of more numerous file and associations studies will be carried out. Knowing the distribution of genotypes is important for assessing the impact of these polymorphisms on various parameters associated with osteoporosis. Screening for identification of “at-risk” women likely to develop osteoporosis and initiating subsequent early intervention appears to be most effective strategy to substantially reduce the risks of osteoporosis.

The Expression of a Novel Gene Encoding an Ankyrin-Repeat Protein, DRA1, is Regulated by Drought-Responsive Alternative Splicing

Year: 2013 Volume: 7 Issue: 12 1172 - 1175 Pages

Abstract: Drought stress is a critical environmental factor that adversely affects crop productivity and quality. Because of their immobile nature, plants have evolved mechanisms to sense and respond to drought stress. We identified a novel locus of Arabidopsis, designated DRA1 (drought responsive ankyrin1), whose disruption leads to increased drought-stress tolerance. DRA1 encodes a transmembrane protein with an ankyrin-repeat motif that has been implicated in diverse cellular processes such as signal transduction. RT-PCR analysis revealed that there were at least two splicing variants of DRA1 transcripts in wild-type plants. In response to drought stress, the levels of DRA1 transcripts retaining second and third introns were increased, whereas these introns were removed under unstressed conditions. These results suggest that DRA1 protein may negatively regulate plant drought tolerance and that the expression of DRA1is regulated in response to drought stress by alternative splicing.

Molecular Detection and Characterization of Infectious Bronchitis Virus from Libya

Year: 2013 Volume: 7 Issue: 12 974 - 976 Pages

Abstract: Infectious bronchitis virus (IBV) is a very dynamic and evolving virus, causing major economic losses to the global poultry industry. Recently, the Libyan poultry industry faced severe outbreak of respiratory distress associated with high mortality and dramatic drop in egg production. Tracheal and cloacal swabs were analyzed for several poultry viruses. IBV was detected using SYBR Green I real-time PCR detection based on the nucleocapsid (N) gene. Sequence analysis of the partial N gene indicated high similarity (~ 94%) to IBV strain 3382/06 that was isolated from Taiwan. Even though the IBV strain 3382/06 is more similar to that of the Mass type H120, the isolate has been implicated associated with intertypic recombinant of 3 putative parental IBV strains namely H120, Taiwan strain 1171/92 and China strain CK/CH/LDL/97I. Complete sequencing and antigenicity studies of the Libya IBV strains are currently underway to determine the evolution of the virus and its importance in vaccine induced immunity. In this paper we documented for the first time the presence of possibly variant IBV strain from Libya which required dramatic change in vaccination program.

The Expression of a Novel Gene Encoding an Ankyrin-Repeat Protein, DRA1, is Regulated by Drought-Responsive Alternative Splicing

Year: 2013 Volume: 7 Issue: 12 1120 - 1123 Pages

Abstract: Drought stress is a critical environmental factor that adversely affects crop productivity and quality. Because of their immobile nature, plants have evolved mechanisms to sense and respond to drought stress. We identified a novel locus of Arabidopsis, designated DRA1 (drought responsive ankyrin1), whose disruption leads to increased drought-stress tolerance. DRA1 encodes a transmembrane protein with an ankyrin-repeat motif that has been implicated in diverse cellular processes such as signal transduction. RT-PCR analysis revealed that there were at least two splicing variants of DRA1 transcripts in wild-type plants. In response to drought stress, the levels of DRA1 transcripts retaining second and third introns were increased, whereas these introns were removed under unstressed conditions. These results suggest that DRA1 protein may negatively regulate plant drought tolerance and that the expression of DRA1is regulated in response to drought stress by alternative splicing.

Influence of Apo E Polymorphism on Coronary Artery Disease

Year: 2009 Volume: 3 Issue: 9 263 - 267 Pages

Abstract: The ε4 allele of the ε2, ε3 and ε4 protein isoform polymorphism in the gene encoding apolipoprotein E (Apo E) has previously been associated with increased cardiac artery disease (CAD); therefore to investigate the significance of this polymorphism in pathogenesis of CAD in Iranian patients with stenosis and control subjects. To investigate the association between  Apo E polymorphism and coronary artery disease we performed a comparative case control study of the frequency of Apo E  polymorphism in One hundred CAD patients with stenosis who underwent coronary angiography (>50% stenosis) and 100 control subjects (

A Novel Multiplex Real-Time PCR Assay Using TaqMan MGB Probes for Rapid Detection of Trisomy 21

Year: 2010 Volume: 4 Issue: 8 687 - 690 Pages

Abstract: Cytogenetic analysis still remains the gold standard method for prenatal diagnosis of trisomy 21 (Down syndrome, DS). Nevertheless, the conventional cytogenetic analysis needs live cultured cells and is too time-consuming for clinical application. In contrast, molecular methods such as FISH, QF-PCR, MLPA and quantitative Real-time PCR are rapid assays with results available in 24h. In the present study, we have successfully used a novel MGB TaqMan probe-based real time PCR assay for rapid diagnosis of trisomy 21 status in Down syndrome samples. We have also compared the results of this molecular method with corresponding results obtained by the cytogenetic analysis. Blood samples obtained from DS patients (n=25) and normal controls (n=20) were tested by quantitative Real-time PCR in parallel to standard G-banding analysis. Genomic DNA was extracted from peripheral blood lymphocytes. A high precision TaqMan probe quantitative Real-time PCR assay was developed to determine the gene dosage of DSCAM (target gene on 21q22.2) relative to PMP22 (reference gene on 17p11.2). The DSCAM/PMP22 ratio was calculated according to the formula; ratio=2 -ΔΔCT. The quantitative Real-time PCR was able to distinguish between trisomy 21 samples and normal controls with the gene ratios of 1.49±0.13 and 1.03±0.04 respectively (p value

Error-Robust Nature of Genome Profiling Applied for Clustering of Species Demonstrated by Computer Simulation

Year: 2007 Volume: 1 Issue: 5 67 - 73 Pages

Abstract: Genome profiling (GP), a genotype based technology, which exploits random PCR and temperature gradient gel electrophoresis, has been successful in identification/classification of organisms. In this technology, spiddos (Species identification dots) and PaSS (Pattern similarity score) were employed for measuring the closeness (or distance) between genomes. Based on the closeness (PaSS), we can buildup phylogenetic trees of the organisms. We noticed that the topology of the tree is rather robust against the experimental fluctuation conveyed by spiddos. This fact was confirmed quantitatively in this study by computer-simulation, providing the limit of the reliability of this highly powerful methodology. As a result, we could demonstrate the effectiveness of the GP approach for identification/classification of organisms.

The Prevalence of Transfusion-Transmitted Virus (TTV) Infection inIranian Patients with Chronic Hepatitis B

Year: 2011 Volume: 5 Issue: 2 70 - 73 Pages

Abstract: TTV is an unenveloped circular single-stranded DNA virus with a diameter of 30-32 nm that first was described in 1997 in Japan. TTV was detected in various populations without proven pathology, including blood donors and in patients with chronic HBV and HCV hepatitis. The aim of this study was to determine the prevalence of TTV DNA in Iranian patients with chronic hepatitis B and C. Viral TTV-DNA was studied in 442 samples (202 with HBV, 138 with HCV and 102 controls) collected from west south of Iran. All extracted serum DNA was amplified by TTV ORF1 gene specific primers using the semi nested PCR technique. TTV DNA was detected in the serum of 8.9% and 10.8% patients with chronic hepatitis B and C, respectively. Prevalence of TTV-DNA in the serum of 102 controls was 2.9%. Results showed significant relation of TTV with HBV and HCV in patients by using T test examination (P

A New blaVIM Gene in a Pseudomonas putida Isolated from ENT Units in Sulaimani Hospitals

Year: 2010 Volume: 4 Issue: 11 852 - 857 Pages

Abstract: A total of twenty tensile biopsies were collected from children undergoing tonsillectomy from teaching hospital ENT department and Kurdistan private hospital in sulaimani city. All biopsies were homogenized and cultured; the obtained bacterial isolates were purified and identified by biochemical tests and VITEK 2 compact system. Among the twenty studied samples, only one Pseudomonas putida with probability of 99% was isolated. Antimicrobial susceptibility was carried out by disk diffusion method, Pseudomonas putida showed resistance to all antibiotics used except vancomycin. The isolate further subjected to PCR and DNA sequence analysis of blaVIM gene using different set of primers for different regions of VIM gene. The results were found to be PCR positive for the blaVIM gene. To determine the sequence of blaVIM gene, DNA sequencing performed. Sequence alignment of blaVIM gene with previously recorded blaVIM gene in NCBI- database showed that P. putida isolate have different blaVIM gene.

Influence of Reaction Temperature and Water Content on Wheat Straw Pyrolysis

Year: 2012 Volume: 6 Issue: 10 970 - 976 Pages

Abstract: The aim of this study was to investigate the influence of reaction temperature and wheat straw moisture content on the pyrolysis product yields, in the temperature range of 475-575 °C. Samples of straw with moisture contents from 1.5 wt % to 15.0 wt % were fed to a bench scale Pyrolysis Centrifuge Reactor (PCR). The experimental results show that the changes in straw moisture content have no significant effect on the distribution of pyrolysis product yields. The maximum bio-oil yields approximately 60 (wt %, on dry ash free feedstock basis) was observed around 525 °C - 550 °C for all straw moisture levels. The water content in the wet straw bio-oil was the highest. The heating value of bio-oil and solid char were measured and the percentages of its energy distribution were calculated. The energy distributions of bio-oil, char and gas were 56- 69 % 24-33 %, and 2-19 %, respectively.

Detection of Salmonella in Egg Shell and Egg Content from Different Housing Systems for Laying Hens

Year: 2010 Volume: 4 Issue: 5 373 - 375 Pages

Abstract: Polymerase chain reaction (PCR) assay and conventional microbiological methods were used to detect bacterial contamination of egg shells and egg content in different commercial housing systems, open house system and evaporative cooling system. A PCR assay was developed for direct detection using a set of primers specific for the invasion by A gene (invA) of Salmonella spp. PCR detected the presence of Salmonella in 2 samples of shell egg from the evaporative cooling system, while conventional cultural methods detected no Salmonella from the same samples.

Long- term Irrigation with Dairy Factory Wastewater Influences Soil Quality

Year: 2010 Volume: 4 Issue: 10 774 - 778 Pages

Abstract: The effects of irrigation with dairy factory wastewater on soil properties were investigated at two sites that had received irrigation for > 60 years. Two adjoining paired sites that had never received DFE were also sampled as well as another seven fields from a wider area around the factory. In comparison with paired sites that had not received effluent, long-term wastewater irrigation resulted in an increase in pH, EC, extractable P, exchangeable Na and K and ESP. These changes were related to the use of phosphoric acid, NaOH and KOH as cleaning agents in the factory. Soil organic C content was unaffected by DFE irrigation but the size (microbial biomass C and N) and activity (basal respiration) of the soil microbial community were increased. These increases were attributed to regular inputs of soluble C (e.g. lactose) present as milk residues in the wastewater. Principal component analysis (PCA) of the soils data from all 11sites confirmed that the main effects of DFE irrigation were an increase in exchangeable Na, extractable P and microbial biomass C, an accumulation of soluble salts and a liming effect. PCA analysis of soil bacterial community structure, using PCR-DGGE of 16S rDNA fragments, generally separated individual sites from one another but did not group them according to irrigation history. Thus, whilst the size and activity of the soil microbial community were increased, the structure and diversity of the bacterial community remained unaffected.