Abstract: There is an essential need for obtaining the mathematical representation of fish body undulations, which can be used for designing and building new innovative types of marine propulsion systems with less environmental impact. This research work presents a case study to derive the mathematical model for fish body movement. Observation and capturing image methods were used in this study in order to obtain a mathematical representation of Clariasbatrachus fish (catfish). An experiment was conducted by using an aquarium with dimension 0.609 m x 0.304 m x 0.304 m, and a 0.5 m ruler was attached at the base of the aquarium. Progressive Scan Monochrome Camera was positioned at 1.8 m above the base of the aquarium to provide swimming sequences. Seven points were marked on the fish body using white marker to indicate the fish movement and measuring the amplitude of undulation. Images from video recordings (20 frames/s) were analyzed frame by frame using local coordinate system, with time interval 0.05 s. The amplitudes of undulations were obtained for image analysis from each point that has been marked on fish body. A graph of amplitude of undulations versus time was plotted by using computer to derive a mathematical fit. The function for the graph is polynomial with nine orders.
Abstract: As Malaysia aims to be a developed country by year 2020; the construction industry has since been identified as a major catalyst for the country to attain the status. It is one of the sectors that contribute to most environmental pollutions. It is, therefore, important for the industry to implement sustainable construction practices to reduce the negative impacts that it has on the environment. However, most Malaysian developers have placed much focus on market demand and economic factors; neglecting the need for attention on environmental issues. The practice of sustainable construction is deemed to be an obstacle to achieve short-term economic goals due to the higher cost incurred in the operations. Hence, choices need to be made and a balance needs to be struck in weighing the long-term environmental benefits against immediate economic factors. This paper discusses the challenges faced by Malaysian developers in adopting sustainable practices in the construction industry and the cause of these challenges. It also looks into the achievements and breakthroughs that developers in Malaysia have achieved so far. The paper aims explores the long-term benefits of sustainable practices that would potentially raise awareness on the feasibility and economic potential of sustainable construction.
Abstract: In this paper, we present a new maintenance model
for a partially observable system subject to two failure modes,
namely a catastrophic failure and a failure due to the system
degradation. The system is subject to condition monitoring and the
degradation process is described by a hidden Markov model. A
cost-optimal Bayesian control policy is developed for maintaining
the system. The control problem is formulated in the semi-Markov
decision process framework. An effective computational algorithm is
developed, illustrated by a numerical example.
Abstract: Turbulent flow in complex geometries receives considerable attention due to its importance in many engineering applications. It has been the subject of interest for many researchers. Some of these interests include the design of storm water channels. The design of these channels requires testing through physical models. The main practical limitation of physical models is the so called “scale effect”, that is, the fact that in many cases only primary physical mechanisms can be correctly represented, while secondary mechanisms are often distorted. These observations form the basis of our study, which centered on problems associated with the design of storm water channels near the Dead Sea, in Israel. To help reach a final design decision we used different physical models. Our research showed good coincidence with the results of laboratory tests and theoretical calculations, and allowed us to study different effects of fluid flow in an open channel. We determined that problems of this nature cannot be solved only by means of theoretical calculation and computer simulation. This study demonstrates the use of physical models to help resolve very complicated problems of fluid flow through baffles and similar structures. The study applies these models and observations to different construction and multiphase water flows, among them, those that include sand and stone particles, a significant attempt to bring to the testing laboratory a closer association with reality.
Abstract: The present environmental issues have made aircraft jet noise reduction a crucial problem in aero-acoustics research. Acoustic studies reveal that addition of chevrons to the nozzle reduces the sound pressure level reasonably with acceptable reduction in performance. In this paper comprehensive numerical studies on acoustic characteristics of different types of chevron nozzles have been carried out with non-reacting flows for the shape optimization of chevrons in supersonic nozzles for aerospace applications. The numerical studies have been carried out using a validated steady 3D density based, k-ε turbulence model. In this paper chevron with sharp edge, flat edge, round edge and U-type edge are selected for the jet acoustic characterization of supersonic nozzles. We observed that compared to the base model a case with round-shaped chevron nozzle could reduce 4.13% acoustic level with 0.6% thrust loss. We concluded that the prudent selection of the chevron shape will enable an appreciable reduction of the aircraft jet noise without compromising its overall performance. It is evident from the present numerical simulations that k-ε model can predict reasonably well the acoustic level of chevron supersonic nozzles for its shape optimization.
Abstract: A phase diagram of the Ag2SO4 - CaSO4 (Silver sulphate – Calcium Sulphate) binaries system using conductivity, XRD (X-Ray Diffraction Technique) and DTA (Differential Thermal Analysis) data is constructed. The eutectic reaction (liquid -» a-Ag2SO4 + CaSO4) is observed at 10 mole% CaSO4 and 645°C. Room temperature solid solubility limit up to 5.27 mole % of Ca 2+ in Ag2SO4 is set using X-ray powder diffraction and scanning electron microscopy results. All compositions beyond this limit are two-phase mixtures below and above the transition temperature (≈ 416°C). The bulk conductivity, obtained following complex impedance spectroscopy, is found decreasing with increase in CaSO4 content. Amongst other binary compositions, the 80AgSO4-20CaSO4 gave improved sinterability/packing density.
Abstract: In the present study, presence of endosulfan, imidacloprid, carbendazim, in the soil /vegetables/cereals and water samples was observed in agriculture fields of Uttarakhand. In view of biodegradation of these pesticides, 9 bacterial isolates were recovered from the soil samples of the fields which tolerated endosulfan, imidacloprid, carbendazim from 100 to 200 µg/ml. Three bacterial consortia used for in vitro bioremediation experiments were consisted of 3 bacterial isolates for carbendazim, imidacloprid and endosulfan, respectively. Maximum degradation (87 and 83%) of α and β endosulfan respectively was observed in soil slurry by consortium. Degradation of Imidacloprid and carbendazim under similar conditions was 88.4 and 77.5% respectively. FT-IR analysis of biodegraded samples of pesticides in liquid media showed stretching of various bonds. GC-MS of biodegraded endosulfan sample in soil slurry showed the presence of nontoxic intermediates. A pot trial with Bacterial treatments lowered down the uptake of pesticides in onion plants.
Abstract: A vacuum fractionation technique was introduced to remove ethanol from fermentation broth. The effect of initial glucose and ethanol concentrations were investigated for specific productivity. The inhibitory ethanol concentration was observed at 100 g/L. In order to increase the fermentation performance, the ethanol product was removed as soon as it is produced. The broth was boiled at 35oC by reducing the pressure to 65 mBar. The ethanol/water vapor was fractionated for up to 90 wt% before leaving the column. Ethanol concentration in the broth was kept lower than 25 g/L, thus minimized the product inhibition effect to the yeast cells. For batch extractive fermentation, a high substrate utilization rate was obtained at 26.6 g/L.h and most of glucose was consumed within 21 h. For repeated-batch extractive fermentation, addition of glucose was carried out up to 9 times and ethanol was produced more than 8-fold higher than batch fermentation.
Abstract: Emotional Intelligence (EI) has been identified as an
important factor for corporate success. However, there are few
empirical findings on the impact of Strategic EI per se. The ooverall
objective of the study was to empirically examine the relationship
between the Strategic EI and Transformational Leadership style of
managers. Sixty four managers were selected from the banking
industry in Czech Republic. Genos EI Inventory, and the Multifactor
Leadership Questionnaire – Form 5X-Short were employed as the
major research instruments of the study. Descriptive and inferential
analyses of survey data were conducted using SPSS software.
Variations were observed among the components of Strategic EI
between males, and females. Study concludes positive a relationship
between Strategic EI of Czech managers and their transformational
leadership style. Improving awareness and usage of EI, will
contribute to facilitate career success through enhanced levels of
transformational leadership of managers.
Abstract: The research about Formal Thai National Costume in the reign of King Bhumibol Adulyadej is an applied research that aimed to study the accurate knowledge concerning to Thai national costume in the reign of King Rama IX, also to study origin of all costumes in the reign of King Rama IX and to study the style, material used, and using accasion. This research methodology which are collect quanlitative data through observation, document, and photograph from key informant of costume in the reign of King Rama IX and from another who related to this field.
The formal Thai national costume of the reign of King Bhumibol Adulyadej originated from the visit of His Majesty the King to Europe and America in 1960. Since Thailand had no traditional national costume; Her Majesty the Queen initiated the idea to create formal Thai national costumes. In 1964, Her Majesty the Queen selected 8 styles of formal Thai national costume. Later, Her Majesty the Queen confered another 3 formal Thai national costume for men. There are 8 styles of formal Thai national costume for women: Thai Ruean Ton, Thai Chit Lada, Thai Amarin, Thai Borom Phiman, Thai Siwalia, Thai Chakkri, Thai Dusit, and Thai Chakkraphat. There are 3 styles of formal Thai national costume for men: short-sleeve shirt, long-sleeve shirt, and long-sleeve shirt with breechcloth. The costume is widely used in formal ceremony such as greeting ceremony for official foreign visitors, wedding ceremony, or other auspicious ceremonies. Now a day, they are always used as a bridal gown as well. The formal Thai national costume is valuable art that shows Thai identity and, should be preserved for the next generation.
Abstract: Analysis of EEG brainwave provides information on mental or emotional states. One of the particular states that can have various applications in human machine interface (HMI) is concentration. 8-channel EEG signals were measured and analyzed. The concentration index was compared during resting and concentrating periods. Among eight channels, locations the frontal lobe (Fp1 and Fp2) showed a clear increase of the concentration index during concentration regardless of subjects. The rest six channels produced conflicting observations depending on subjects. At this time, it is not clear whether individual difference or how to concentrate made these results for the rest six channels. Nevertheless, it is expected that Fp1 and Fp2 are promising locations for extracting control signal for HMI applications.
Abstract: The effect of tillage technology of maize on intensity of weed infestation and weed species composition was observed at experimental field. Maize is grown consecutively since 2001. The experimental site is situated at an altitude of 230 m above sea level in the Czech Republic. Variants of tillage technology are CT: plowing – conventional tillage 0.22 m, MT: loosening – disc tillage on the depth of 0.1 – 0.12 m, NT: direct sowing – without tillage. The evaluation of weed infestation was carried out by numerical method in years 2012 and 2013. Within the monitoring were found 20 various species of weeds. Conventional tillage (CT) primarily supports the occurrence of perennial weeds (Cirsium arvense, Convolvulus arvensis). Late spring species (Chenopodium album, Echinochloa crus-galli) were more frequently noticed on variants of loosening (MT) and direct sowing (NT). Different tillage causes a significant change of weed species spectrum in maize.
Abstract: The Indian subcontinent is facing a massive challenge with regards to energy security in its member countries; to provide reliable electricity to facilitate development across various sectors of the economy and consequently achieve the developmental targets. The instability of the current precarious situation is observable in the frequent system failures and blackouts.
The deployment of interconnected electricity ‘Supergrid’ designed to carry huge quanta of power across the Indian sub-continent is proposed in this paper. Not only enabling energy security in the subcontinent it will also provide a platform for Renewable Energy Sources (RES) integration. This paper assesses the need and conditions for a Supergrid deployment and consequently proposes a meshed topology based on Voltage Source High Voltage Direct Current (VSC- HVDC) converters for the Supergrid modeling. Various control schemes for the control of voltage and power are utilized for the regulation of the network parameters. A 3 terminal Multi Terminal Direct Current (MTDC) network is used for the simulations.
Abstract: The aim of this study was to determine the antimicrobial effect of Helichrysum arenarium L. essential oil in "in-vitro" condition on the growth of seven microbial species including Bacillus subtilis, Escherichia coli, Staphylococcus aureus, Saccharomyces cereviciae, Candida albicans, Aspergillus flavus and Aspergillus parasiticus using micro-dilution method. The minimum inhibitory concentration (MIC) and minimum bactericidal or fungicidal concentration (MBC, MFC) were determined for the essential oil at ten concentrations. Finally, the sensitivity of tested microbes to essential oil of H. arenarium was investigated. Results showed that Bacillus subtilis (MIC=781.25 and MBC=6250 µg/ml) was more resistance than two other bacterial species. Among the tested yeasts, Saccharomyces cereviciae (MIC=97.65 and MFC=781.25 µg/ml) was more sensitive than Candida albicans while among the fungal species, growth of Aspergillus parasiticus inhibited at lower concentration of oil than the Aspergillus flavus. The extracted essential oil exhibited the same MIC value in the liquid medium against all fungal strains (48.82 µg/ml), while different activity against A. flavus and A. parasiticus was observed in this medium with MFC values of 6250 and 390.625µg/ml, respectively. The results of the present study indicated that Helichrysum arenarium L essential oil had significant (P
Abstract: Microwave dielectric ceramic materials of
(Mg1-xNix)2(Ti0.95Sn0.05)O4 for x = 0.01, 0.03, 0.05, 0.07 and 0.09 were
prepared and sintered at 1250–1400 ºC. The microstructure and
microwave dielectric properties of the ceramic materials were
examined and measured. The observations shows that the content of
Ni2+ ions has little effect on the crystal structure, dielectric constant,
temperature coefficient of resonant frequency (τf) and sintering
temperatures of the ceramics. However, the quality values (Q×f) are
greatly improved due to the addition of Ni2+ ions. The present study
showed that the ceramic material prepared for x = 0.05 and sintered at
1325ºC had the best Q×f value of 392,000 GHz, about 23%
improvement compared with that of Mg2(Ti0.95Sn0.05)O4.
Abstract: Analyzing brain signals of the patients suffering from the state of depression may lead to interesting observations in the signal parameters that is quite different from a normal control. The present study adopts two different methods: Time frequency domain and nonlinear method for the analysis of EEG signals acquired from depression patients and age and sex matched normal controls. The time frequency domain analysis is realized using wavelet entropy and approximate entropy is employed for the nonlinear method of analysis. The ability of the signal processing technique and the nonlinear method in differentiating the physiological aspects of the brain state are revealed using Wavelet entropy and Approximate entropy.
Abstract: Wireless communications have been expanded very fast in recent decades. This technology relies on an extensive network of base stations and antennas, using radio frequency signals to transmit information. Devices that use wireless communication, while offering various services, basically act as sources of non-ionizing electromagnetic fields (EMF). Such devices are permanently present in human vicinity and almost constantly radiate, causing EMF pollution of the environment. This fact has initiated development of modern systems for observation of the EMF pollution, as well as for risk assessment. This paper presents the Serbian electromagnetic field monitoring network – SEMONT, designed for automated, remote and continuous broadband monitoring of EMF in the environment. Measurement results of the SEMONT monitoring at one of the test locations, within the main campus of the University of Novi Sad, are presented and discussed, along with corresponding exposure assessment of the general population, regarding the Serbian legislation.
Abstract: Background: The high prevalence of obesity in Egypt has a great impact on the health care system, economic and social situation. Evidence suggests that even a moderate amount of weight loss can be useful. Aim of the study: To analyze the effects of lower body positive pressure supported treadmill training, conducted with hypocaloric diet, on body composition of obese children. Methods: Thirty children aged between 8 and 14 years, were randomly assigned into two groups: intervention group (15 children) and control group (15 children). All of them were evaluated using body composition analysis through bioelectric impedance. The following parameters were measured before and after the intervention: body mass, body fat mass, muscle mass, body mass index (BMI), percentage of body fat and basal metabolic rate (BMR). The study group exercised with antigravity treadmill three times a week during 2 months, and participated in a hypocaloric diet program. The control group participated in a hypocaloric diet program only. Results: Both groups showed significant reduction in body mass, body fat mass and BMI. Only study group showed significant reduction in percentage of body fat (p = 0.0.043). Changes in muscle mass and BMR didn't reach statistical significance in both groups. No significant differences were observed between groups except for muscle mass (p = 0.049) and BMR (p = 0.042) favoring study group. Conclusion: Both programs proved effective in the reduction of obesity indicators, but lower body positive pressure supported treadmill training was more effective in improving muscle mass and BMR.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.