Scholarly

Mineral Nitrogen Retention, Nitrogen Availability and Plant Growth in the Soil Influenced by Addition of Organic and Mineral Fertilizers – Lysimetric Experiment

Year: 2014 Volume: 8 Issue: 8 911 - 915 Pages

Abstract: Compost can influence soil fertility and plant health. At the same time compost can play an important role in the nitrogen cycle and it can influence leaching of mineral nitrogen from soil to underground water. This paper deals with the influence of compost addition and mineral nitrogen fertilizer on leaching of mineral nitrogen, nitrogen availability in microbial biomass and plant biomass production in the lysimetric experiment. Twenty one lysimeters were filed with topsoil and subsoil collected in the area of protection zone of underground source of drinking water - Březová nad Svitavou. The highest leaching of mineral nitrogen was detected in the variant fertilized only mineral nitrogen fertilizer (624.58 mg m-2), the lowest leaching was recorded in the variant with high addition of compost (315.51 mg m-2). On the other hand, losses of mineral nitrogen are not in connection with the losses of available form of nitrogen in microbial biomass. Because lost of mineral nitrogen was detected in variant with the least change in the availability of N in microbial biomass. The leaching of mineral nitrogen, yields as well as the results concerning nitrogen availability from the first year of long term experiment suggest that compost can positive influence the leaching of nitrogen into underground water.

Reading Strategy Awareness of English Major Students

Year: 2014 Volume: 8 Issue: 8 2669 - 2673 Pages

Authors:
Hsin-Yi Lien

Abstract: The study explored the role of metacognition in foreign language anxiety on a sample of 411 Taiwanese students of English as a Foreign Language. The reading strategy inventory was employed to evaluate the tertiary learners’ level of metacognitive awareness and a semi-structured background questionnaire was also used to examine the learners’ perceptions of their English proficiency and satisfaction of their current English learning. In addition, gender and academic level differences in employment of reading strategies were investigated. The results showed the frequency of reading strategy use increase slightly along with academic years and males and females actually employ different reading strategies. The EFL tertiary learners in the present study utilized cognitive strategies more frequently than metacognitive strategies or support strategies. Male students use metacognitive strategy more often while female students use cognitive and support strategy more frequently.

Japanese English in Travel Brochures

Year: 2014 Volume: 8 Issue: 8 2644 - 2648 Pages

Authors:
Premvadee Na Nakornpanom

Abstract: This study investigates the role and impact of English loan words on Japanese language in travel brochures. The issues arising from a potential switch to English as a tool to absorb the West’s advanced knowledge and technology in the modernization of Japan to a means of linking Japan with the rest of the world and enhancing the country’s international presence. Sociolinguistic contexts was used to analyze data collected from the Nippon Travel agency "HIS"’s brochures in Thailand, revealing that English plays the most important role as lexical gap fillers and special effect givers. An increasing mixer of English to Japanese affects how English is misused, the way the Japanese see the world and the present generation’s communication gap.

Sustainable Urban Waterfronts Using Sustainability Assessment Rating System

Year: 2014 Volume: 8 Issue: 4 488 - 498 Pages

Authors:
R. M. R. Hussein

Abstract: Sustainable urban waterfront development is one of the most interesting phenomena of urban renewal in the last decades. However, there are still many cities whose visual image is compromised due to the lack of a sustainable urban waterfront development, which consequently affects the place of those cities globally. This paper aims to reimagine the role of waterfront areas in city design, with a particular focus on Egypt, so that they provide attractive, sustainable urban environments while promoting the continued aesthetic development of the city overall. This aim will be achieved by determining the main principles of a sustainable urban waterfront and its applications. This paper concentrates on sustainability assessment rating systems. A number of international case-studies, wherein a city has applied the basic principles for a sustainable urban waterfront and have made use of sustainability assessment rating systems, have been selected as examples which can be applied to the urban waterfronts in Egypt. This paper establishes the importance of developing the design of urban environments in Egypt, as well as identifying the methods of sustainability application for urban waterfronts.

Effects of Different Sowing Dates on Oil Yield of Castor (Ricinus communis L.)

Year: 2014 Volume: 8 Issue: 2 184 - 188 Pages

Abstract: Castor (Ricinus communis L.) is one of the important non-edible oilseed crops having immense industrial and medicinal value. Oil yield per unit area is the ultimate target in growing oilseed plants and sowing date is one of the important factors which have a clear role on production of active substances particularly in oilseeds. This study was conducted to evaluate the effect of sowing date on the seed and oil yield of castor in Central Anatolia of Turkey in 2011. The field experiment was set up in a completely randomized block design with three replications. Black Diamond-2 castor cultivar was used as plant material. The treatment was four sowing dates of May 10, May 25, June 10, June 25. In this research; seed yield, oil content and oil yield were investigated. Results showed that the effect of different sowing dates were significant on all of characteristics. In general; delayed sowing dates, resulted in decreased seed yield, oil content and oil yield. The highest value of seed yield, oil content and oil yield (respectively, 2523.7 kg ha-1, 51.18% and 1292.2 kg ha-1) were obtained from the first sowing date (May 10) while the lowest seed yield, oil content and oil yield (respectively, 1550 kg ha-1, 43.67%, 677.3 kg ha-1) were recorded from the latest sowing date (June 25). Therefore, it can be concluded that early May could be recommended as an appropriate sowing date in the studied location and similar climates for achieved high oil yield of castor.

Technology for Enhancing the Learning and Teaching Experience in Higher Education

Year: 2014 Volume: 8 Issue: 8 2608 - 2616 Pages

Abstract: The rapid development and growth of technology has changed the method of obtaining information for educators and learners. Technology has created a new world of collaboration and communication among people. Incorporating new technology into the teaching process can enhance learning outcomes. Billions of individuals across the world are now connected together, and are cooperating and contributing their knowledge and intelligence. Time is no longer wasted in waiting until the teacher is ready to share information as learners can go online and get it immediatelt. The objectives of this paper are to understand the reasons why changes in teaching and learning methods are necessary, to find ways of improving them, and to investigate the challenges that present themselves in the adoption of new ICT tools in higher education institutes. To achieve these objectives two primary research methods were used: questionnaires, which were distributed among students at higher educational institutes and multiple interviews with faculty members (teachers) from different colleges and universities, which were conducted to find out why teaching and learning methodology should change. The findings show that both learners and educators agree that educational technology plays a significant role in enhancing instructors’ teaching style and students’ overall learning experience; however, time constraints, privacy issues, and not being provided with enough up-to-date technology do create some challenges.

Developing Intellectual Capital to Advance Innovation and Entrepreneurial Capacity and Sustain Knowledge Economy

Year: 2014 Volume: 8 Issue: 8 2576 - 2580 Pages

Abstract: Both knowledge economy and sustainable development are considered key dimensions in the policy action lines of many developed and developing countries. In this context, universities and other higher education institutes have a vital role in developing and sustaining wellbeing communities. In this paper, the authors’ aim is to address the links between the concepts of innovation and entrepreneurial capacity and knowledge economy, and to utilize the approach of intellectual capital development in building a sustainable knowledge economy. The paper will contribute to two discourses: Developing a common understanding of the intersection aspects between the three concepts: Knowledge economy, Innovation and entrepreneurial system, and sustainable development. Paving the road towards developing an integrated multidimensional framework for sustainable knowledge economy.

Perspective and Challenge of Tidal Power in Bangladesh

Year: 2014 Volume: 8 Issue: 7 1172 - 1175 Pages

Abstract: Tidal power can play a vital role in integrating as new source of renewable energy to the off-grid power connection in isolated areas, namely Sandwip, in Bangladesh. It can reduce the present energy crisis and improve the social, environmental and economic perspective of Bangladesh. Tidal energy is becoming popular around the world due to its own facilities. The development of any country largely depends on energy sector improvement. Lack of energy sector is because of hampering progress of any country development, and the energy sector will be stable by only depend on sustainable energy sources. Renewable energy having environmental friendly is the only sustainable solution of secure energy system. Bangladesh has a huge potential of tidal power at different locations, but effective measures on this issue have not been considered sincerely. This paper summarizes the current energy scenario, and Bangladesh can produce power approximately 53.19 MW across the country to reduce the growing energy demand utilizing tidal energy as well as it is shown that Sandwip is highly potential place to produce tidal power, which is estimated approximately 16.49 MW by investing only US $10.37 million. Besides this, cost management for tidal power plant has been also discussed.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Year: 2014 Volume: 8 Issue: 7 765 - 771 Pages

Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Tribological Investigation and the Effect of Karanja Biodiesel on Engine Wear in Compression Ignition Engine

Year: 2014 Volume: 8 Issue: 2 489 - 494 Pages

Abstract: Various biomass based resources, which can be used as an extender, or a complete substitute of diesel fuel may have very significant role in the development of agriculture, industrial and transport sectors in the energy crisis. Use of Karanja oil methyl ester biodiesel in a CI DI engine was found highly compatible with engine performance along with lower exhaust emission as compared to diesel fuel but with slightly higher NOx emission and low wear characteristics. The combustion related properties of vegetable oils are somewhat similar to diesel oil. Neat vegetable oils or their blends with diesel, however, pose various long-term problems in compression ignition engines. These undesirable features of vegetable oils are because of their inherent properties like high viscosity, low volatility, and polyunsaturated character. Pongamia methyl ester (PME) was prepared by transesterification process using methanol for long term engine operations. The physical and combustion-related properties of the fuels thus developed were found to be closer to that of the diesel. A neat biodiesel (PME) was selected as a fuel for the tribological study of biofuels. Two similar new engines were completely disassembled and subjected to dimensioning of various vital moving parts and then subjected to long-term endurance tests on neat biodiesel and diesel respectively. After completion of the test, both the engines were again disassembled for physical inspection and wear measurement of various vital parts. The lubricating oil samples drawn from both engines were subjected to atomic absorption spectroscopy (AAS) for measurement of various wear metal traces present. The additional lubricating property of biodiesel fuel due to higher viscosity as compared to diesel fuel resulted in lower wear of moving parts and thus improved the engine durability with a bio-diesel fuel. Results reported from AAS tests confirmed substantially lower wear and thus improved life for biodiesel operated engines.

Online Metacognitive Reading Strategies Use by Postgraduate Libyan EFL Students

Year: 2014 Volume: 8 Issue: 7 2304 - 2307 Pages

Authors:
Najwa Alsayed Omar

Abstract: With the increasing popularity of the Internet, online reading has become an essential source for EFL readers. Using strategies to comprehend information on online reading texts play a crucial role in students’ academic success. Metacognitive reading strategies are effective factors that enhance EFL learners reading comprehension. This study aimed at exploring the use of online metacognitive reading strategies by postgraduate Libyan EFL students. Quantitative data was collected using the Survey of Online Reading Strategies (OSORS). The findings revealed that the participants were moderate users of metacognitive online reading strategies. Problem solving strategies were the most frequently reported used strategies, while support reading strategies were the least. The five most and least frequently reported strategies were identified. Based on the findings, some future research recommendations were presented.

Hedonic Motivations for Online Shopping

Year: 2014 Volume: 8 Issue: 7 2238 - 2240 Pages

Abstract: The purpose of this study is to investigate hedonic online shopping motivations. A qualitative analysis was conducted to explore the factors influencing online hedonic shopping motivations. The results of the study indicate that traditional hedonic values, consisting of social, role, self-gratification, learning trends, pleasure of bargaining, stimulation, diversion, status, and adventure, and dimensions of flow theory, consisting of control, curiosity, enjoyment, and telepresence, exist in the online shopping environment. Two hedonic motivations unique to Internet shopping, privacy and online shopping achievement, were found. It appears that the most important hedonic value to online shoppers is having the choice to interact or not interact with others while shopping on the Internet. This study serves as a basis for the future growth of Internet marketing.

An Enhanced Floor Estimation Algorithm for Indoor Wireless Localization Systems Using Confidence Interval Approach

Year: 2014 Volume: 8 Issue: 7 1202 - 1206 Pages

Abstract: Indoor wireless localization systems have played an important role to enhance context-aware services. Determining the position of mobile objects in complex indoor environments, such as those in multi-floor buildings, is very challenging problems. This paper presents an effective floor estimation algorithm, which can accurately determine the floor where mobile objects located. The proposed algorithm is based on the confidence interval of the summation of online Received Signal Strength (RSS) obtained from the IEEE 802.15.4 Wireless Sensor Networks (WSN).We compare the performance of the proposed algorithm with those of other floor estimation algorithms in literature by conducting a real implementation of WSN in our facility. The experimental results and analysis showed that the proposed floor estimation algorithm outperformed the other algorithms and provided highest percentage of floor accuracy up to 100% with 95-percent confidence interval.

Gender Differences in Negotiation: Considering the Usual Driving Forces?

Year: 2014 Volume: 8 Issue: 7 2224 - 2229 Pages

Abstract: Negotiation is a specific form of interaction based on communication in which the parties enter into deliberately, each with clear but different interests or goals and a mutual dependency towards a decision due to be taken at the end of the confrontation. Consequently, negotiation is a complex activity involving many different disciplines from the strategic aspects and the decision making process to the evaluation of alternatives or outcomes and the exchange of information. While gender differences can be considered as one of the most researched topic within negotiation studies, empirical works and theory present many conflicting evidences and results about the role of gender in the process or the outcome. Furthermore, little interest has been shown over gender differences in the definition of what is negotiation, its essence or fundamental elements. Or, as differences exist in practices, it might be essential to study if the starting point of these discrepancies does not come from different considerations about what is negotiation and what will encourage the participants in their strategic decisions. Some recent and promising experiments made with diverse groups show that male and female participants in a common and shared situation barely consider the same way the concepts of power, trust or stakes which are largely considered as the usual driving forces of any negotiation. Furthermore, results from Human Resource self-assessment tests display and confirm considerable differences between individuals regarding essential behavioral dimensions like capacity to improvise and to achieve, aptitude to conciliate or to compete and orientation towards power and group domination which are also part of negotiation skills. Our intention in this paper is to confront these dimensions with negotiation’s usual driving forces in order to build up new paths for further research.

Leadership´s Controlling via Complexity Investigation in Crisis Scenarios

Year: 2014 Volume: 8 Issue: 7 2213 - 2217 Pages

Abstract: In this paper will be discussed two coin´s sides of crisis scenarios dynamics. On the one's side is negative role of subsidiary scenario branches in its compactness weakening by means unduly chaotic atomizing, having many interactive feedbacks cases, increasing a value of a complexity here. This negative role reflects the complexity of use cases, weakening leader compliancy, which brings something as a ´readiness for controlling capabilities provision´. Leader´s dissatisfaction has zero compliancy, but factual it is a ´crossbar´ (interface in fact) between planning and executing use cases. On the other side of this coin, an advantage of rich scenarios embranchment is possible to see in a support of response awareness, readiness, preparedness, adaptability, creativity and flexibility. Here rich scenarios embranchment contributes to the steadiness and resistance of scenario mission actors. These all will be presented in live power-points ´Blazons´, modelled via DYVELOP (Dynamic Vector Logistics of Processes) on the Conference.

The Effects of NaF Concentration on the Zinc Coating Electroplated in Supercritical CO2 Mixed Zinc Chloride Bath

Year: 2014 Volume: 8 Issue: 7 682 - 687 Pages

Abstract: This research studies the electroplating of zinc coating in the zinc chloride bath mixed with supercritical CO2. The sodium fluoride (NaF) was used as the bath additive to change the structure and property of the coating, and therefore the roughness and corrosion resistance of the zinc coating was investigated. The surface characterization was performed using optical microscope (OM), X-ray diffractometer (XRD), and α-step profilometer. Moreover, the potentiodynamic polarization measurement in 3% NaCl solution was employed in the corrosion resistance evaluation. Because of the emulsification of the electrolyte mixed in Sc-CO2, the electroplated zinc produced the coating with smoother surface, smaller grain, better throwing power and higher corrosion resistance. The main role played by the NaF was to reduce the coating’s roughness and grain size. In other words, the CO2 mixed with the electrolyte under the supercritical condition performed the similar function as brighter and leveler in zinc electroplating to enhance the throwing power and corrosion resistance of the coating.

The New Approach to Airport Emergency Plans

Year: 2014 Volume: 8 Issue: 8 2528 - 2531 Pages

Abstract: This article deals with a new approach to the airport emergency plans, which are the basic documents and manuals for dealing with events with impact on safety or security. The article describes the identified parts in which the current airport emergency plans do not fulfill their role and which should therefore be considered in the creation of corrective measures. All these issues have been identified at airports in the Czech Republic and confirmed at airports in neighboring countries.

Closing Africa’s Infrastructure Deficit: The Role of Gender Responsiveness in Urban Planning

Year: 2014 Volume: 8 Issue: 3 878 - 886 Pages

Abstract: Although urbanization in Africa has been characterized by fragile socio-economic successes, the sustainability of city infrastructure is now central to planning processes as a pathway to closing the deficit in terms of coverage and access. This paper builds on survey and interview data from Kampala city, to demonstrate how the principle gender responsiveness can inform improvements in urban infrastructure and service delivery. We discovered that women prefer infrastructure that combines living and working spaces for reduced labour and travel burdens between homes, markets, schools, and other urban spaces. Men’s conception of infrastructure needs on the other hand, mirrored public security and connectivity concerns along city streets and work places. However, the urban planning approach at city-level is guided by mainstream engineering and architectural designs that do not necessarily reflect the social context within which urban infrastructure influences gender roles and the attendant mobility needs. To address the challenge across cities of similar context, the paper concludes with a set of analytic steps on how the gendered influences on infrastructure-use can be considered in urban planning cycles.

Methanation Catalyst for Low CO Concentration

Year: 2014 Volume: 8 Issue: 7 652 - 655 Pages

Abstract: A Ni-based catalyst supported by γ-Al2O3 was prepared by impregnation method, and the catalyst was used in a low CO and CO2 concentration methanation system. The effect of temperature, pressure and space velocity on the methanation reaction was investigated in an experimental fixed-bed reactor. The methanation reaction was operated at the conditions of 190-240°C, 3000-24000ml•g-1•h-1 and 1.5-3.5MPa. The results show that temperature and space velocity play important role on the reaction. With the increase of reaction temperature the CO and CO2 conversion increase and the selectivity of CH4 increase. And with the increase of the space velocity the conversion of CO and CO2 and the selectivity of CH4 decrease sharply.

Community-Based Destination Sustainable Development: Case of Cicada Walking Street, Hua Hin, Thailand

Year: 2014 Volume: 8 Issue: 6 1961 - 1966 Pages

Authors:
Pongsiri Kingkan

Abstract: This paper aims to study the role and activities of the participants and the impact of activities created in the local area in order to sustainably develop the local areas. This study applied both qualitative and quantitative approaches presented in descriptive style; the data was collected via survey, observation and in-depth interviews with samples. The results illustrated five sorts of roles of participants of the Cicada Walking-street and four types of creative activities; recreation based, art based, cultural based, and live events. Integration of local characteristics, arts and cultures were presented creatively and interestingly. Participants are various. The roles of the participants found in the Cicada Market are group of the property and area management, entrepreneurs, leisure (entertaining persons), local people, and tourists. The good impacts on local communities are those in terms of economy, environmental friendly and local arts and cultures promoting. On the other hand, the traffic congestion, waste and the increasing of energy consumption are negative impacts from area development.

Top Journal

SUGGEST A JOURNAL