Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This paper is aimed to investigate farmers’ level of awareness and behavior of chemical pesticide uses, by using a case study of Suan Luang Sub- District Municipality, Ampawa, Samut Songkram Province. Questionnaire was employed in this study with the farmers from 46 households to explore their level of awareness in chemical pesticide uses, while interview and observation were adopted in exploring their behavior of chemical pesticide uses. The findings reflected the farmers’ high level of awareness in chemical pesticide uses in the hazardous effects of the chemical to human and environmental health, while their behavior of chemical pesticide uses explained their awareness paid to the right way of using pesticides, for instance reading the direction on the label, keeping children and animals away from the area of pesticide mixing, covering body with clothes and wearing hat and mask, no smoking, eating or drinking during pesticide spray or standing in windward direction.
Abstract: We installed solar panels and digital meteorological equipments whose electrical power is supplied using PV on July 13, 2011. Then, the relationship between the electric power generation and the irradiation, air temperature, and wind velocity was investigated on a roof at a university. The electrical power generation, irradiation, air temperature, and wind velocity were monitored over two years. By analyzing the measured meteorological data and electric power generation data using PTC, we calculated the size of the solar panel that is most suitable for this system. We also calculated the wasted power generation using PTC with the measured meteorological data obtained in this study. In conclusion, to reduce the "wasted power generation", a smaller-size solar panel is required for stable operation.
Abstract: In this paper, a fifth order propagator operators are proposed for estimating the Angles Of Arrival (AOA) of narrowband electromagnetic waves impinging on antenna array when its number of sensors is larger than the number of radiating sources.
The array response matrix is partitioned into five linearly dependent phases to construct the noise projector using five different propagators from non diagonal blocks of the spectral matrice of the received data; hence, five different estimators are proposed to estimate the angles of the sources. The simulation results proved the performance of the proposed estimators in the presence of white noise comparatively to high resolution eigen based spectra.
Abstract: In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem. Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA).
Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.
Abstract: The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: This paper deals with the problem of delay-dependent
stability for neural networks with distributed delays. Some new
sufficient condition are derived by constructing a novel
Lyapunov-Krasovskii functional approach. The criteria are
formulated in terms of a set of linear matrix inequalities, this is
convenient for numerically checking the system stability using the
powerful MATLAB LMI Toolbox. Moreover, in order to show the
stability condition in this paper gives much less conservative results
than those in the literature, numerical examples are considered.
Abstract: In recent years, geographic information systems (GIS)
and remote sensing using has increased to estimate runoff catchment.
In this research, runoff curve number maps for captive catchment of
Tehran by helping GIS and also remote sensing which based on
factors such as vegetation, lands using, group of soil hydrology and
hydrological conditions were obtained. Runoff curve numbers map
was obtained by combining these maps in ARC GIS and SCS table.
To evaluate the accuracy of the results, the maximum flow rate of
flood which was obtained from curve numbers, was compared with
the measured maximum flood rate at the watershed outlet and
correctness of curve numbers were approved.
Abstract: Effects of insertion of coiled wire in juxtaposition with twisted tapes on heat transfer rate and solar radiation without disturbing the flow inside the riser tubes in a solar flat plate collector is experimentally reconnoitered in this present work. The wire coil used as a turbulator is placed inside the riser tube while the twisted tape is inserted into the wire coil to create a continuous swirling flow along the tube wall. The results of the heat transfer have been compared well with the available results. The heat transfer rate in the collector has been found to be increased by 18% to 70%. Solar water heaters having inserts in the flow tubes perform better than the conventional plain ones. It has been observed that heat losses are reduced consequently increasing the thermal performance about 30% over the plain water heaters under the same operating conditions. The effect of twisted tape with wire coils, flow Reynolds number, and the intensity of solar radiation on the thermal performance of the solar water heater has been presented. Effects of insertion of coiled wire in juxtaposition with twisted tapes on heat transfer rate and solar radiation without disturbing the flow inside the riser tubes in a solar flat plate collector is experimentally reconnoitered in this present work. The wire coil used as a turbulator is placed inside the riser tube while the twisted tape is inserted into the wire coil to create a continuous swirling flow along the tube wall. The results of the heat transfer have been compared well with the available results. The heat transfer rate in the collector has been found to be increased by 18% to 70%. Solar water heaters having inserts in the flow tubes perform better than the conventional plain ones. It has been observed that heat losses are reduced consequently increasing the thermal performance about 30% over the plain water heaters under the same operating conditions. The effect of twisted tape with wire coils, flow Reynolds number, and the intensity of solar radiation on the thermal performance of the solar water heater has been presented.
Abstract: High temperature is one of the most detrimental
effects that cause important changes in concrete’s mechanical,
physical, and thermo-physical properties. As a result of these
changes, especially high strength concrete (HSC), may exhibit
damages such as cracks and spallings. To overcome this problem,
incorporating polymer fibers such as polypropylene (PP) in concrete
is a very well-known method. In this study, using RRH, as a
sustainable material, instead of PP fiber in HSC to prevent spallings
and improve physical and thermo-physical properties were
investigated. Therefore, seven HSC mixtures with 0.25 water to
binder ratio were prepared incorporating silica fume and blast furnace
slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of
cement, respectively. All specimens were subjected to high
temperatures (20 (control), 300, 600 and 900˚C) with a heating rate
of 2.5˚C/min and after cooling, residual physical and thermo-physical
properties were determined.
Abstract: CNFET has emerged as an alternative material to
silicon for high performance, high stability and low power SRAM
design in recent years. SRAM functions as cache memory in
computers and many portable devices. In this paper, a new SRAM
cell design based on CNFET technology is proposed. The proposed
SRAM cell design for CNFET is compared with SRAM cell designs
implemented with the conventional CMOS and FinFET in terms of
speed, power consumption, stability, and leakage current. The
HSPICE simulation and analysis show that the dynamic power
consumption of the proposed 8T CNFET SRAM cell’s is reduced
about 48% and the SNM is widened up to 56% compared to the
conventional CMOS SRAM structure at the expense of 2% leakage
power and 3% write delay increase.
Abstract: This study compared the mechanical and microstructural properties produced during friction stir welding (FSW) of S275 structural steel in air and underwater. Post weld tests assessed the tensile strength, micro-hardness, distortion, Charpy impact toughness and fatigue performance in each case. The study showed that there was no significant difference in the strength, hardness or fatigue life of the air and underwater specimens. However, Charpy impact toughness was shown to decrease for the underwater specimens and was attributed to a lower degree of recrystallization caused by the higher rate of heat loss experienced when welding underwater. Reduced angular and longitudinal distortion was observed in the underwater welded plate compared to the plate welded in air.
Abstract: The semiconductor industry is placing an increased
emphasis on emerging materials and devices that may provide
improved performance, or provide novel functionality for devices.
Recently, graphene, as a true two-dimensional carbon material, has
shown fascinating applications in electronics. In this paper detailed
discussions are introduced for possible applications of grapheme
Transistor in RF and digital devices.
Abstract: The copyrights system is a combination of different elements. The number, content and the correlation of these elements are different for different legal orders. The models of copyrights systems display this system in terms of the interaction of economic and author's moral rights. Monistic and dualistic models are the most popular ones. The article deals with different points of view on the monism and dualism in copyright system. A specific model of the copyright in Switzerland in the XXth century is analyzed. The evolution of a French dualistic model of copyright is shown. The author believes that one should talk not about one, but rather about a number of dualism forms of copyright system.
Abstract: Purpose: This E-survey was carried out to facilitate the implementation and Education of VMAT (Volumetric Modulated Arc Therapy) in Radiotherapy-RT departments and reasons for not using IMRT (Intensity Modulated Radiotherapy). VMAT Skills in demand were also identified. Method: E-Survey was distributed to NHS hospitals across UK by email. Thirty NHS and related centres in England, 21 in Scotland, 3 in Ireland and 1 in Wales were contacted. This Survey was intended for those working in RT and Medical Physics and who were responsible for Treatment Planning and training. Results: This E-survey have indicated pathways adopted by staff to acquire VMAT skills, strategies to efficiently implement VMAT in RT departments and for obtaining VMAT Education. Conclusion: Despite poor survey response this survey has managed to highlight requirements for education and implementation of VMAT that are also applicable to IMRT. Other RT centres in world can also find these results useful.
Abstract: Localization of mobile robots are important tasks for
developing autonomous mobile robots. This paper proposes a method
to estimate positions of a mobile robot using a omnidirectional
camera on the robot. Landmarks for points of references are set
up on a field where the robot works. The omnidirectional camera
which can obtain 360 [deg] around images takes photographs of
these landmarks. The positions of the robots are estimated from
directions of these landmarks that are extracted from the images
by image processing. This method can obtain the robot positions
without accumulative position errors. Accuracy of the estimated
robot positions by the proposed method are evaluated through some
experiments. The results show that it can obtain the positions with
small standard deviations. Therefore the method has possibilities of
more accurate localization by tuning of appropriate offset parameters.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: A polypropylene hollow fiber membrane module is used for separating dissolved gases which contain dissolved oxygen from water. These dissolved gases can be used for underwater breathing. To be used for a human, the minimum amount of oxygen is essential. To increase separation of dissolved gases, much water and high surface area of hollow fibers are requested. For efficient separation system, performance of single membrane module with high surface area needs to be investigated.
In this study, we set up experimental devices for analyzing separation characteristics of dissolved gases including oxygen from water using a polypropylene hollow fiber membrane module. Separation of dissolved gases from water is investigated with variations of water flow rates. Composition of dissolved gases is also measured using GC. These results expect to be used in developing the portable separation system.