Alexandria’s Eastern Entrance: Analysis of Qaitbay Waterfront Development

Water is a fundamental attraction in all cultures and among all classes of people,tourists and citizens. It is a favorite location for major tourism initiatives, celebrations and ceremonies. The vitality of any city depends on citizen action to take part in creating the neighborhoods they desire. Waterfront can provide extensive new areas of high quality public open space in parts of the city that are popular venues for social activities and also have the highest land values. Each city must have a character that can be used as a key attraction for the development. The morphology of a waterfront can be identified by both its physical characteristics and the socio-cultural activities that take place in the area. Alexandria has been selected as an area of study because it has a unique character due to its possession of a variety of waterfronts. This paper aims to set some criteria of successful waterfront development and then through these criteria analyzing the development of the Qaitbay waterfront in the eastern harbor in Alexandria, Egypt. Hence, a comprehensive improvement of the waterfront areas is certainly needed to ensure a successful waterfront development radiated the sense of uniformity and coherence. Alexandria can benefit from these criteria to develop its urban waterfront in order to preserve and revitalize its unique waterfront character and achieve mixed uses and tourism development.

Investigation of Electrical, Thermal and Structural Properties on Polyacrylonitrile Nano-Fiber

Polymer composite nano-fibers including (1, 3 wt %) silver nano-particles have been produced by electrospinning method. Polyacrylonitrile/N,N-dimethylformamide (PAN/DMF) solution have been prepared and the amount of silver nitrate have been adjusted to PAN weight. Silver nano-particles were obtained from reduction of silver ions into silver nano-particles by chemical reduction by hydrazine hydroxide (N2H5OH). The different amount of silver salt was loaded into polymer matrix to obtain polyacrylonitrile composite nano-fiber containing silver nano-particles. The effect of the amount of silver nano-particles on the properties of composite nano-fiber web was investigated. Electrical conductivity, mechanical properties, thermal properties were examined by Microtest LCR Meter 6370 (0.01 mΩ-100 MΩ), Tensile tester, Differential scanning calorimeter DSC (Q10) and SEM respectively. Also antimicrobial efficiency test (ASTM E2149-10) was done against to Staphylococcus aureus bacteria. It has been seen that breaking strength, conductivity, antimicrobial effect, enthalpy during cyclization increase by use of silver nano-particles while the diameter of nano-fiber decreases.

Characterization of Banana (Musa spp.) Pseudo-Stem and Fruit-Bunch-Stem as a Potential Renewable Energy Resource

Banana pseudo-stem and fruit-bunch-stem are agricultural residues that can be used for conversion to bio-char, biooil, and gases by using thermochemical process. The aim of this work is to characterize banana pseudo-stem and banana fruit-bunch-stem through proximate analysis, elemental analysis, chemical analysis, thermo-gravimetric analysis, and heating calorific value. The ash contents of the banana pseudo-stem and banana fruit-bunch-stem are 11.0 mf wt.% and 20.6 mf wt.%; while the carbon content of banana pseudo-stem and fruit-bunch-stem are 37.9 mf wt.% and 35.58 mf wt.% respectively. The molecular formulas for banana stem and banana fruit-bunch-stem are C24H33NO26 and C19H29NO33 respectively. The measured higher heating values of banana pseudostem and banana fruit-bunch-stem are 15.5MJ/kg and 12.7 MJ/kg respectively. By chemical analysis, the lignin, cellulose, and hemicellulose contents in the samples will also be presented. The feasibility of the banana wastes to be a feedstock for thermochemical process in comparison with other biomass will be discussed in this paper.

On The Design of Robust Governors of Steam Power Systems Using Polynomial and State-Space Based H∞ Techniques: A Comparative Study

This work presents a comparison study between the state-space and polynomial methods for the design of the robust governor for load frequency control of steam turbine power systems. The robust governor is synthesized using the two approaches and the comparison is extended to include time and frequency domains performance, controller order, and uncertainty representation, weighting filters, optimality and sub-optimality. The obtained results are represented through tables and curves with reasons of similarities and dissimilarities.

Influence of Seasons on Honeybee Wooden Hives Attack by Termites in Port Harcourt, Nigeria

Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.

Advertising Appeals and Cultural Values in Social Media Commercials in UK, Brasil and India: Case Study of Nokia and Samsung

The objectives of this study is to investigate the impact of culture on advertising appeals in mobile phone industry via social media channel in UK, Brazil and India. Content analysis on Samsung and Nokia commercials in YouTube is conducted. The result indicates that the advertising appeals are both congruent and incongruent with cultural dimensions in UK, Brazil and India. The result suggests that Hofstede and value paradoxes might be the tools to predict the relationship between cultural values and advertising appeals.

Orthogonal Regression for Nonparametric Estimation of Errors-in-Variables Models

Two new algorithms for nonparametric estimation of errors-in-variables models are proposed. The first algorithm is based on penalized regression spline. The spline is represented as a piecewise-linear function and for each linear portion orthogonal regression is estimated. This algorithm is iterative. The second algorithm involves locally weighted regression estimation. When the independent variable is measured with error such estimation is a complex nonlinear optimization problem. The simulation results have shown the advantage of the second algorithm under the assumption that true smoothing parameters values are known. Nevertheless the use of some indexes of fit to smoothing parameters selection gives the similar results and has an oversmoothing effect.

Potentials of Raphia hookeri Wine in Livelihood Sustenance among Rural and Urban Populations in Nigeria

Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.

A Review: Comparative Study of Diverse Collection of Data Mining Tools

There have been a lot of efforts and researches undertaken in developing efficient tools for performing several tasks in data mining. Due to the massive amount of information embedded in huge data warehouses maintained in several domains, the extraction of meaningful pattern is no longer feasible. This issue turns to be more obligatory for developing several tools in data mining. Furthermore the major aspire of data mining software is to build a resourceful predictive or descriptive model for handling large amount of information more efficiently and user friendly. Data mining mainly contracts with excessive collection of data that inflicts huge rigorous computational constraints. These out coming challenges lead to the emergence of powerful data mining technologies. In this survey a diverse collection of data mining tools are exemplified and also contrasted with the salient features and performance behavior of each tool.

Half-Circle Fuzzy Number Threshold Determination via Swarm Intelligence Method

In recent years, many researchers are involved in the field of fuzzy theory. However, there are still a lot of issues to be resolved. Especially on topics related to controller design such as the field of robot, artificial intelligence, and nonlinear systems etc. Besides fuzzy theory, algorithms in swarm intelligence are also a popular field for the researchers. In this paper, a concept of utilizing one of the swarm intelligence method, which is called Bacterial-GA Foraging, to find the stabilized common P matrix for the fuzzy controller system is proposed. An example is given in in the paper, as well.

Parallel Particle Swarm Optimization Optimized LDI Controller with Lyapunov Stability Criterion for Nonlinear Structural Systems

In this paper, we present a neural-network (NN) based approach to represent a nonlinear Tagagi-Sugeno (T-S) system. A linear differential inclusion (LDI) state-space representation is utilized to deal with the NN models. Taking advantage of the LDI representation, the stability conditions and controller design are derived for a class of nonlinear structural systems. Moreover, the concept of utilizing the Parallel Particle Swarm Optimization (PPSO) algorithm to solve the common P matrix under the stability criteria is given in this paper.

Metal-Based Anticancer Agents: In vitro DNA Binding, Cleavage and Cytotoxicity

Two new metal-based anticancer chemotherapeutic agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]- Cl.CH3OH.H2O 2, were designed, prepared and characterized by analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR) techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted octahedral and distorted trigonal-bipyramidal, respectively. Both 1 and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2 and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1 (2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible absorption studies suggest non-classical electrostatic mode of interaction via phosphate backbone of DNA double helix. The Stern- Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 × 106 M-1) determined by fluorescence studies suggests the groove binding and intercalation mode for 1 and 2, respectively. Effective cleavage of pBR322 DNA is induced by 1.Their interaction with DNA of cancer cells may account for potency.

Simulation of Die Casting Process in an Industrial Helical Gearbox Flange Die

Flanges are widely used for connecting valves, pipes and other industrial devices such as gearboxes. Method of producing a flange has a considerable impact on the manner of their involvement with the industrial engines and gearboxes. By Using die casting instead of sand casting and machining for manufacturing flanges, production speed and dimensional accuracy of the parts increases. Also, in die casting, obtained dimensions are close to final dimensions and hence the need for machining flanges after die casting process decreases which makes a significant savings in raw materials and improves the mechanical properties of flanges. In this paper, a typical die of an industrial helical gearbox flange (size ISO 50) was designed and die casting process for producing this type of flange was simulated using ProCAST software. The results of simulation were used for optimizing die design. Finally, using the results of the analysis, optimized die was built.

Material Characterization and Numerical Simulation of a Rubber Bumper

Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.

Perspective and Challenge of Tidal Power in Bangladesh

Tidal power can play a vital role in integrating as new source of renewable energy to the off-grid power connection in isolated areas, namely Sandwip, in Bangladesh. It can reduce the present energy crisis and improve the social, environmental and economic perspective of Bangladesh. Tidal energy is becoming popular around the world due to its own facilities. The development of any country largely depends on energy sector improvement. Lack of energy sector is because of hampering progress of any country development, and the energy sector will be stable by only depend on sustainable energy sources. Renewable energy having environmental friendly is the only sustainable solution of secure energy system. Bangladesh has a huge potential of tidal power at different locations, but effective measures on this issue have not been considered sincerely. This paper summarizes the current energy scenario, and Bangladesh can produce power approximately 53.19 MW across the country to reduce the growing energy demand utilizing tidal energy as well as it is shown that Sandwip is highly potential place to produce tidal power, which is estimated approximately 16.49 MW by investing only US $10.37 million. Besides this, cost management for tidal power plant has been also discussed.

A Review of Control Schemes for Active Power Filters in Order to Power Quality Improvement

Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.

Detection ofTensile Forces in Cable-Stayed Structures Using the Advanced Hybrid Micro-Genetic Algorithm

This study deals with an advanced numerical techniques to detect tensile forces in cable-stayed structures. The proposed method allows us not only to avoid the trap of minimum at initial searching stage but also to find their final solutions in better numerical efficiency. The validity of the technique is numerically verified using a set of dynamic data obtained from a simulation of the cable model modeled using the finite element method. The results indicate that the proposed method is computationally efficient in characterizing the tensile force variation for cable-stayed structures.

Case Study: Linking Career Education to University Education in Japan

Japanese society is experiencing an aging population and declining birth rate along with the popularization of higher education, spread of economic globalization, rapid progress in technical innovation, changes in employment conditions, and emergence of a knowledge-based society. Against this background, interest in career education at Japanese universities has increased in recent years. This paper describes how the government has implemented career education policies in Japan, and introduces the cases of two universities that have successfully linked career education to university education in Japan.

Thermodynamic Analysis of Cascade Refrigeration System Using R12-R13, R290-R23 and R404A-R23

The Montreal protocol and Kyoto protocol underlined the need of substitution of CFC’s and HCFC’s due to their adverse impact on atmospheric ozone layer which protects earth from U.V rays. The CFCs have been entirely ruled out since 1995 and a long-term basis HCFCs must be replaced by 2020. All this events motivated HFC refrigerants which are harmless to ozone layer. In this paper thermodynamic analysis of cascade refrigeration system has been done using three different refrigerant pairs R13-R12, R290-R23, and R404A-R23. Effect of various operating parameters i.e. evaporator temperature, condenser temperature, temperature difference in cascade condenser and low temperature cycle condenser temperature on performance parameters viz. COP, exergetic efficiency and refrigerant mass flow ratio have been studied. Thermodynamic analysis shows that out of three refrigerant pairs R12-R13, R290-R23 and R404A-R23 the COP of R290-R23 refrigerant pair is highest.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.