Abstract: The Montreal protocol and Kyoto protocol underlined the need of substitution of CFC’s and HCFC’s due to their adverse impact on atmospheric ozone layer which protects earth from U.V rays. The CFCs have been entirely ruled out since 1995 and a long-term basis HCFCs must be replaced by 2020. All this events motivated HFC refrigerants which are harmless to ozone layer. In this paper thermodynamic analysis of cascade refrigeration system has been done using three different refrigerant pairs R13-R12, R290-R23, and R404A-R23. Effect of various operating parameters i.e. evaporator temperature, condenser temperature, temperature difference in cascade condenser and low temperature cycle condenser temperature on performance parameters viz. COP, exergetic efficiency and refrigerant mass flow ratio have been studied. Thermodynamic analysis shows that out of three refrigerant pairs R12-R13, R290-R23 and R404A-R23 the COP of R290-R23 refrigerant pair is highest.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.
Abstract: Purpose: This E-survey was carried out to facilitate the implementation and Education of VMAT (Volumetric Modulated Arc Therapy) in Radiotherapy-RT departments and reasons for not using IMRT (Intensity Modulated Radiotherapy). VMAT Skills in demand were also identified. Method: E-Survey was distributed to NHS hospitals across UK by email. Thirty NHS and related centres in England, 21 in Scotland, 3 in Ireland and 1 in Wales were contacted. This Survey was intended for those working in RT and Medical Physics and who were responsible for Treatment Planning and training. Results: This E-survey have indicated pathways adopted by staff to acquire VMAT skills, strategies to efficiently implement VMAT in RT departments and for obtaining VMAT Education. Conclusion: Despite poor survey response this survey has managed to highlight requirements for education and implementation of VMAT that are also applicable to IMRT. Other RT centres in world can also find these results useful.
Abstract: The protective effect of hesperidin was investigated in
rats exposed to liver injury induced by a single intraperitoneal
injection of cyclophosphamide (CYP) at a dose of 150 mg kg-1.
Hesperidin treatment (100 mg kg-1/day, orally) was applied for seven
days, starting five days before CYP administration. Hesperidin
significantly decreased the CYP-induced elevations of serum alanine
aminotransferase, and hepatic malondialdehyde and myeloperoxidase
activity, significantly prevented the depletion of hepatic glutathione
peroxidase activity resulted from CYP administration. Also,
hesperidin ameliorated the CYP-induced liver tissue injury observed
by histopathological examination. In addition, hesperidin decreased
the CYP-induced expression of inducible nitric oxide synthase, tumor
necrosis factor-α, cyclooxygenase-2, Fas ligand, and caspase-9 in
liver tissue. It was concluded that hesperidin may represent a
potential candidate to protect against CYP-induced hepatotoxicity.
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.
Abstract: This study was aimed to investigate the effect of
various organic supplements on growth and development of
Dendrobium discolor’s protocorms and seedlings growth of
Dendrobium Judy Rutz. Protocorms of Dendrobium discolor with 2.0
cm. in diameter and seedlings of Dendrobium Judy Rutz at the same
size (0.5 cm. height) were sub-cultured on Hyponex medium
supplemented with cow milk (CM), soy milk (SM), potato extract
(PE) and peptone (P) for 2 months. The protocorms were developed
to seedlings in all treatments after cultured for 2 months. However,
the best results were found on Hyponex medium supplemented with
P was the best in which the maximum fresh and dry weight and
maximum shoot height were obtained in this treatment statistically
different (p ≤ 0.05) to other treatments. Moreover, Hyponex medium
supplemented with P also stimulated the maximum mean number of
5.7 shoots per explant which also showed statistically different (p ≤
0.05) when compared to other treatments. The results of growth of
Dendrobium Judy Rutz seedlings indicated the medium
supplemented with 100 mL/L PE enhanced the maximum fresh and
dry weigh per explants with significantly different (p ≤ 0.05) in fresh
weight from other treatments including the control medium without
any organic supplementation. However, the dry weight was not
significantly different (p ≤ 0.05) from medium supplemented with
SM and P. There was multiple shoots induction in all media with or
without organic supplementation ranging from 2.6 to 3 shoots per
explants. The maximum shoot height was also obtained in the
seedlings cultured on medium supplemented with PE while the
longest root length was found in medium supplemented with SM.
Abstract: This study aimed to investigate effect of different organic supplements on growth of Vanda and Mokara seedlings. Vanda and Mokara seedlings approximately 0.2 and 0.3 cm. in height were sub-cultured onto VW supplemented with 150 ml/L coconut water, 100 g/L potato extract, 100 g/L ‘Gros Michel’ banana (AAA group) and 100 g/L ‘Namwa’ banana (ABB group). The explants were sub-cultured onto the same medium every month for 3 months. The best medium increased stem height to 0.52 and 0.44 Cm. in Vanda and Mokara respectively was supplemented with coconut water. The maximum fresh weight of Vanda (0.59 g) was found on medium supplemented with ‘Gros Michel’ banana while Mokara cultured on medium supplemented with Potato extract had the maximum fresh weight (0.27 g) and number of roots (5.20 roots/shoot) statistically different (p≤ 0.05) to other treatments. However, Vanda cultured on medium supplemented with ‘Namwa’ banana had the maximum number of roots (3.80 roots/shoot). Our results suggested that growth of different orchid genera was responded diversely to different organic supplements.
Abstract: A hydroponic trial was carried out to investigate the effect of molybdenum (Mo) on uptake of phosphorus (P) in different rice cultivars. The experiment was conducted using a randomized complete-block design, with a split-plot arrangement of treatments and three replications. Four rates of Mo (0, 0.01, 0.1 and 1 mg L−1) and five cultivars (MR219, HASHEMI, MR232, FAJRE and MR253) provided the main and sub-plots, respectively. Interaction of molybdenum×variety was significant on shoot phosphorus uptake (p≤0.01). Highest and lowest shoot phosphorus uptake were seen in Mo3V3 (0.6% plant-1) and Mo0V3 (0.14% plant-1) treatments, respectively. Molybdenum did not have a significant effect on root phosphorus content. According to results, application of molybdenum has a synergistic effect on uptake of phosphorus by rice plants.
Abstract: Gypsum is being applied to ameliorate subsoil acidity and to overcome the problem of very slow lime movement from surface lime applications. Reduced Crude Conversion Spent Lime (RCCSL) containing anhydrite was evaluated for use as a liming material with specific consideration given to the movement of sulfate into the acid subsoil. Agricultural lime and RCCSL were applied at 0, 0.5, 1.0, and 1.5 times the lime requirement of 6.72 Mg ha-1 to an acid Trappist silt loam (TypicHapuldult). Corn [Zea mays (L.)]was grown following lime material application and soybean [Glycine max (L.) Merr.]was grown in the second year.Soil pH increased rapidly with the addition of the RCCSL material. Over time there was no difference in soil pH between the materials but there was with increasing rate. None of the observed changes in plant nutrient concentration had an impact on yield. Grain yield was higher for the RCCSL amended treatments in the first year but not in the second. There was a significant increase in soybean grain yield from the full lime requirement treatments over no lime.
Abstract: We used 24 Ile de France lambs, weighing between 15 and 32 kg (BW). Treatments were supplemented with concentrate: “in nature” sugarcane (IN), sugarcane hydrolyzed using 0.6% calcium oxide (CaO) under aerobic condition (AER), and sugarcane hydrolyzed using 0.6% CaO under anaerobic condition (ANA), constituting a completely randomized design with eight repetitions per treatment. Lambs were housed in individual stalls and fed into the through, allowing 10% of leftovers. Lambs were slaughtered when body weight reached 32 kg. The following parameters were determined on Longissimu lumborum muscle of hot and cold carcasses: pH and color, 45 minutes and 24 hours after slaughtering. Qualitative analysis of the meat were performed in the loins, water-holding capacity (WHC), cooking loss (CL), and shear force (SF). We used a completely randomized design with three treatments and eight repetitions. Means were compared by Tukey test at 5% significance. A higher value for redness (a*) 45 minutes after slaughter (10.48) were found for lambs fed hydrolyzed under anaerobic conditions sugarcane. The other qualitative characteristics of meat were not affected by treatments (P >0.05). The comparison of meat quality resulting from the treatments shows that it is possible to feed in nature sugarcane to lambs, thus waiving hydrolyses process and the spending with alkalizing agent.
Abstract: This research aims to create a knowledge-based system as a database for self-healthcare analysis, diagnosis of simple illnesses, and the use of Thai herbs instead of modern medicine by using principles of Thai traditional medication theory. These were disseminated by website network programs within Suan Sunandha Rajabhat University. The population used in this study was divided into two groups: the first group consisted of four experts of Thai traditional medication and the second group was 300 website users. The methods used for collecting data were paper questionnaires and poll questionnaires on the website. The statistics used for analyzing data was at an average level. The results were divided into three parts: the first part was the development of a knowledge-based system and the second part was applied programs on website. Both parts could be fulfilled and achieved according to the set goal. The third part was the evaluation of the study: The evaluation of the viewpoints of the experts towards website designs were evaluated at a good level of 4.20. The satisfaction evaluation of the users was found at a good level of average satisfactory level at 4.24. It was found that the young population of those under the age of 16 had less cares about their health than the population of other teenagers, working age adults and those of older age. The research findings should be extended in order to encourage the lifestyle modifications to people of all ages by using the self-healthcare principles.
Abstract: The linguistic competence of Thai university students majoring in Business English was examined in the context of knowledge of English language inflection, and also various linguistic elements. Errors analysis was applied to the results of the testing. Levels of errors in inflection, tense and linguistic elements were shown to be significantly high for all noun, verb and adjective inflections. Findings suggest that students do not gain linguistic competence in their use of English language inflection, because of interlanguage interference. Implications for curriculum reform and treatment of errors in the classroom are discussed.
Abstract: Regular exercise promotes reduction in blood pressure, reduction in body weight and it also helps to increase in insulin sensitivity. Participation in physical activity should always be linked to medical screening which can reveal serious medical problems. One of them is high blood pressure. Hypertension is risk factor for one billion people worldwide and the highest prevalence is found in Africa. Another component of hypertension is that people who suffer from hypertension have no symptoms. It is estimated that reduction of 3mm Hg in Systolic Blood Pressure decreases cardiac morbidity at least 5%. The most of the guidelines suggest aerobic exercise in a prevention of cardiovascular diseases. On the other hand, it is important to emphasize the impact of resistance training. Even, it was found higher effect for reduction on the level of systolic blood pressure than aerobic exercise.
Abstract: Local utilities often face problems of local industrial
wastes, storm water disposal due to existing strict regulations. For
many local industries, the problem of wastewater treatment and
discharge into surface reservoirs can’t be solved through the use of
conventional biological treatment techniques. Current discharge
standards require very strict removal of a number of impurities such
as ammonia, nitrates, phosphate, etc. To reach this level of removal,
expensive reagents and sorbents are used.
The modern concept of rational water resources management
requires the development of new efficient techniques that provide
wastewater treatment and reuse.
As RO membranes simultaneously reject all dissolved impurities
such as BOD, TDS, ammonia, phosphates etc., they become very
attractive for the direct treatment of wastewater without biological
stage. To treat wastewater, specially designed membrane "open
channel" modules are used that do not possess "dead areas" that cause
fouling or require pretreatment. A solution to RO concentrate
disposal problem is presented that consists of reducing of initial
wastewater volume by 100 times. Concentrate is withdrawn from
membrane unit as sludge moisture. The efficient use of membrane
RO techniques is connected with a salt balance in water system.
Thus, to provide high ecological efficiency of developed techniques,
all components of water supply and wastewater discharge systems
should be accounted for.
Abstract: In this study, the Mo-electrode thin films were deposited using two-stepped process and the high purity copper indium selenide-based powder (CuInSe2, CIS) was fabricated by using hydrothermal process by Nanowin Technology Co. Ltd. Because the CIS powder was aggregated into microscale particles, the CIS power was ground into nano-scale particles. 6 wt% CIS particles were mixed and dispersed into isopropyl alcohol (IPA). A new non-vacuum thin-film deposition process, spray coating method (SPM), was investigated to deposit the high-densified CIS absorber layers. 0.1 ml CIS solution was sprayed on the 20 mm×10 mm Mo/glass substrates and then the CuInSe2 thin films were annealed in a selenization furnace using N2 as atmosphere. The annealing temperature and time were set at 550oC and 5 min, and 0.0g~0.6g extra Se content was added in the furnace. The influences of extra Se content on the densification, crystallization, resistivity (ρ), hall mobility (μ), and carrier concentration of the CIS absorber layers were well investigated in this study.
Abstract: In this study, we investigated (In,Ga,Zn)Ox (IGZO) thin films and examined their characteristics of using Ga2O3-2 ZnO (GZO) co-sputtered In2O3 prepared by dual target radio frequency magnetron sputtering at room temperature in a pure Ar atmosphere. RF powers of 80 W and 70 W were used for GZO and pure In2O3, room temperature (RT) was used as deposition temperature, and the deposition time was changed from 15 min to 60 min. Structural, surface, electrical, and optical properties of IGZO thin films were investigated as a function of deposition time. Furthermore, the GZO co-sputtered In2O3 thin films showed a very smooth and featureless surface and an amorphous structure regardless of the deposition time due to the room temperature sputtering process. We would show that the co-sputtered IGZO thin films exhibited transparent electrode properties with high transmittance ratio and low resistivity.
Abstract: The inhibition of SH2 domain regulated protein-protein interactions is an attractive target for developing an effective chemotherapeutic approach in the treatment of disease. Molecular simulation is a useful tool for developing new drugs and for studying molecular recognition. In this study, we searched potential drug compounds for the inhibition of SH2 domain by performing structural similarity search in PubChem Compound Database. A total of 37 compounds were screened from the database, and then we used the LibDock docking program to evaluate the inhibition effect. The best three compounds (AP22408, CID 71463546 and CID 9917321) were chosen for MD simulations after the LibDock docking. Our results show that the compound CID 9917321 can produce a more stable protein-ligand complex compared to other two currently known inhibitors of Src SH2 domain. The compound CID 9917321 may be useful for the inhibition of SH2 domain based on these computational results. Subsequently experiments are needed to verify the effect of compound CID 9917321 on the SH2 domain in the future studies.
Abstract: Soybean Natto powder was added to the burger in order to enhance the oxidative stability as well as decreases the microbial spoilage. The soybean bioactives compound (soybean Natto) as antioxidant and antimicrobial were added at level of 1, 2 and 3%. Chemical analysis and physical properties were affected by soybean Natto addition. All the tested soybean Natto additives showed strong antioxidant properties. The microbiological indicators were significantly (P < 0.05) affected by the addition of the soybean Natto. Decreasing trends of different extent were also observed in samples of the treatments for total viable counts, Coliform, Staphylococcus aureus, yeast and molds. Storage period was significantly (P < 0.05) affected on microbial counts in all samples Staphylococcus aureus were the most sensitive microbe followed by Coliform group of the sample containing soybean Natto. Sensory attributes were also performed, added soybean Natto exhibits beany flavor which was clear about samples of 3% soybean Natto.
Abstract: Ambrosia trifida L. is designated as invasive alien
species by the Act on the Conservation and Use of Biodiversity by the
Ministry of Environment, Korea. The purpose of present paper was to
investigate the inhibitory effects of aqueous extracts of A.trifida on the
development of root hairs of Triticum aestivum L., and Allium
tuberosum Rottler ex Spreng and the electrophoretic protein patterns of
their radicles. The development of root hairs was inhibited by
increasing of aqueous extract concentrations. Through SDS-PAGE,
the electrophoretic protein bands of extracted proteins from their
radicles were appeared in controls, but protein bands of specific
molecular weight disappeared or weakened in treatments. In
conclusion, inhibitory effects of A. trifida made two receptor species
changed morphologically, and at the molecular level in early growth
stage.