Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: This paper is aimed to investigate farmers’ level of awareness and behavior of chemical pesticide uses, by using a case study of Suan Luang Sub- District Municipality, Ampawa, Samut Songkram Province. Questionnaire was employed in this study with the farmers from 46 households to explore their level of awareness in chemical pesticide uses, while interview and observation were adopted in exploring their behavior of chemical pesticide uses. The findings reflected the farmers’ high level of awareness in chemical pesticide uses in the hazardous effects of the chemical to human and environmental health, while their behavior of chemical pesticide uses explained their awareness paid to the right way of using pesticides, for instance reading the direction on the label, keeping children and animals away from the area of pesticide mixing, covering body with clothes and wearing hat and mask, no smoking, eating or drinking during pesticide spray or standing in windward direction.
Abstract: We installed solar panels and digital meteorological equipments whose electrical power is supplied using PV on July 13, 2011. Then, the relationship between the electric power generation and the irradiation, air temperature, and wind velocity was investigated on a roof at a university. The electrical power generation, irradiation, air temperature, and wind velocity were monitored over two years. By analyzing the measured meteorological data and electric power generation data using PTC, we calculated the size of the solar panel that is most suitable for this system. We also calculated the wasted power generation using PTC with the measured meteorological data obtained in this study. In conclusion, to reduce the "wasted power generation", a smaller-size solar panel is required for stable operation.
Abstract: In this paper, a fifth order propagator operators are proposed for estimating the Angles Of Arrival (AOA) of narrowband electromagnetic waves impinging on antenna array when its number of sensors is larger than the number of radiating sources.
The array response matrix is partitioned into five linearly dependent phases to construct the noise projector using five different propagators from non diagonal blocks of the spectral matrice of the received data; hence, five different estimators are proposed to estimate the angles of the sources. The simulation results proved the performance of the proposed estimators in the presence of white noise comparatively to high resolution eigen based spectra.
Abstract: In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem. Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA).
Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.
Abstract: The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: High temperature is one of the most detrimental
effects that cause important changes in concrete’s mechanical,
physical, and thermo-physical properties. As a result of these
changes, especially high strength concrete (HSC), may exhibit
damages such as cracks and spallings. To overcome this problem,
incorporating polymer fibers such as polypropylene (PP) in concrete
is a very well-known method. In this study, using RRH, as a
sustainable material, instead of PP fiber in HSC to prevent spallings
and improve physical and thermo-physical properties were
investigated. Therefore, seven HSC mixtures with 0.25 water to
binder ratio were prepared incorporating silica fume and blast furnace
slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of
cement, respectively. All specimens were subjected to high
temperatures (20 (control), 300, 600 and 900˚C) with a heating rate
of 2.5˚C/min and after cooling, residual physical and thermo-physical
properties were determined.
Abstract: This study compared the mechanical and microstructural properties produced during friction stir welding (FSW) of S275 structural steel in air and underwater. Post weld tests assessed the tensile strength, micro-hardness, distortion, Charpy impact toughness and fatigue performance in each case. The study showed that there was no significant difference in the strength, hardness or fatigue life of the air and underwater specimens. However, Charpy impact toughness was shown to decrease for the underwater specimens and was attributed to a lower degree of recrystallization caused by the higher rate of heat loss experienced when welding underwater. Reduced angular and longitudinal distortion was observed in the underwater welded plate compared to the plate welded in air.
Abstract: The copyrights system is a combination of different elements. The number, content and the correlation of these elements are different for different legal orders. The models of copyrights systems display this system in terms of the interaction of economic and author's moral rights. Monistic and dualistic models are the most popular ones. The article deals with different points of view on the monism and dualism in copyright system. A specific model of the copyright in Switzerland in the XXth century is analyzed. The evolution of a French dualistic model of copyright is shown. The author believes that one should talk not about one, but rather about a number of dualism forms of copyright system.
Abstract: Localization of mobile robots are important tasks for
developing autonomous mobile robots. This paper proposes a method
to estimate positions of a mobile robot using a omnidirectional
camera on the robot. Landmarks for points of references are set
up on a field where the robot works. The omnidirectional camera
which can obtain 360 [deg] around images takes photographs of
these landmarks. The positions of the robots are estimated from
directions of these landmarks that are extracted from the images
by image processing. This method can obtain the robot positions
without accumulative position errors. Accuracy of the estimated
robot positions by the proposed method are evaluated through some
experiments. The results show that it can obtain the positions with
small standard deviations. Therefore the method has possibilities of
more accurate localization by tuning of appropriate offset parameters.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: A polypropylene hollow fiber membrane module is used for separating dissolved gases which contain dissolved oxygen from water. These dissolved gases can be used for underwater breathing. To be used for a human, the minimum amount of oxygen is essential. To increase separation of dissolved gases, much water and high surface area of hollow fibers are requested. For efficient separation system, performance of single membrane module with high surface area needs to be investigated.
In this study, we set up experimental devices for analyzing separation characteristics of dissolved gases including oxygen from water using a polypropylene hollow fiber membrane module. Separation of dissolved gases from water is investigated with variations of water flow rates. Composition of dissolved gases is also measured using GC. These results expect to be used in developing the portable separation system.
Abstract: Farmers are in need of regular and relevant information relating to new technologies. Production of extension materials has been found to be useful in facilitating the process. Extension materials help to provide information to reach large numbers of farmers quickly and economically. However, as good as extension materials are, previous materials produced are not used by farmers. The reasons for this include lack of involvement of farmers in the production of the extension materials, most of the extension materials are not relevant to the farmers’ environments, the agricultural extension agents lack capacity to prepare the materials, and many extension agents lack commitment. These problems led to this innovative capacity building of extension agents. This innovative approach involves five stages. The first stage is the diagnostic survey of farmers’ environment to collect useful information. The second stage is the development and production of draft extension materials. The third stage is the field testing and evaluation of draft materials by the same famers that were involved at the diagnostic stage. The fourth stage is the revision of the draft extension materials by incorporating suggestions from farmers. The fifth stage is the action plans. This process improves the capacity of agricultural extension agents in the preparation of extension materials and also promotes engagement of farmers and beneficiaries in the process. The process also makes farmers assume some level of ownership of the exercise and the extension materials.
Abstract: We present results from experimental price-setting oligopolies in which green firms undertake different levels of energy-saving investments motivated by public subsidies and demand-side advantages. We find that consumers reveal higher willingness to pay for greener sellers’ products. This observation in conjunction to the fact that greener sellers set higher prices is compatible with the use and interpretation of energy-saving behaviour as a differentiation strategy. However, sellers do not exploit the resulting advantage through sufficiently high price-cost margins, because they seem trapped into “run to stay still” competition. Regarding the use of public subsidies to energy-saving sellers we uncover an undesirable crowding-out effect of consumers’ intrinsic tendency to support green manufacturers. Namely, consumers may be less willing to support a green seller whose energy-saving strategy entails a direct financial benefit. Finally, we disentangle two alternative motivations for consumer’s attractions to pro-social firms; first, the self-interested recognition of the firm’s contribution to the public and private welfare and, second, the need to compensate a firm for the cost entailed in each pro-social action. Our results show the prevalence of the former over the latter.
Abstract: Outrigger-braced wall systems are commonly used to provide high rise buildings with the required lateral stiffness for wind and earthquake resistance. The existence of outriggers adds to the stiffness and strength of walls as reported by several studies. The effects of different parameters on the elasto-plastic dynamic behavior of outrigger-braced wall systems to earthquakes are investigated in this study. Parameters investigated include outrigger stiffness, concrete strength, and reinforcement arrangement as the main design parameters in wall design. In addition to being significantly affect the wall behavior, such parameters may lead to the change of failure mode and the delay of crack propagation and consequently failure as the wall is excited by earthquakes. Bi-linear stress-strain relation for concrete with limited tensile strength and truss members with bi-linear stress-strain relation for reinforcement were used in the finite element analysis of the problem. The famous earthquake record, El-Centro, 1940 is used in the study. Emphasize was given to the lateral drift, normal stresses and crack pattern as behavior controlling determinants. Results indicated significant effect of the studied parameters such that stiffer outrigger, higher grade concrete and concentrating the reinforcement at wall edges enhance the behavior of the system. Concrete stresses and cracking behavior are too much enhanced while less drift improvements are observed.
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: In this paper the design, fabrication, and testing of a miniaturized rectangular microstrip patch antenna loaded with DNG metamaterials is reported. The metamaterial is composed of two nested spiral strips and a single straight strip which are etched on two sides of a 5.7 mm×5.7 mm Rogers RT/duroid 5880 with 0.5 mm thickness and dielectric constant of 2.2. Two units of this structure as a double negative (DNG) medium in combination with air as a double positive (DPS) medium are used as substrate of the microstrip patch antenna. By placing these metamaterial structures under the patch, a sub-wavelength resonance occurs which leads to a smaller size patch antenna compared to the conventional antenna at that frequency. The total size of the proposed antenna is reduced 54.6%. The dimensions of the proposed patch antenna are significantly smaller than the wavelength of the operation frequency with respect to the conventional patch antenna. Simulation result and test result for the proposed patch antenna are given and compared.