Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: In recent years, many researchers are involved in the
field of fuzzy theory. However, there are still a lot of issues to be
resolved. Especially on topics related to controller design such as the
field of robot, artificial intelligence, and nonlinear systems etc.
Besides fuzzy theory, algorithms in swarm intelligence are also a
popular field for the researchers. In this paper, a concept of utilizing
one of the swarm intelligence method, which is called Bacterial-GA
Foraging, to find the stabilized common P matrix for the fuzzy
controller system is proposed. An example is given in in the paper, as
well.
Abstract: In this paper, we present a neural-network (NN) based
approach to represent a nonlinear Tagagi-Sugeno (T-S) system. A
linear differential inclusion (LDI) state-space representation is utilized
to deal with the NN models. Taking advantage of the LDI
representation, the stability conditions and controller design are
derived for a class of nonlinear structural systems. Moreover, the
concept of utilizing the Parallel Particle Swarm Optimization (PPSO)
algorithm to solve the common P matrix under the stability criteria is
given in this paper.
Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.
Abstract: Japanese society is experiencing an aging population and declining birth rate along with the popularization of higher education, spread of economic globalization, rapid progress in technical innovation, changes in employment conditions, and emergence of a knowledge-based society. Against this background, interest in career education at Japanese universities has increased in recent years. This paper describes how the government has implemented career education policies in Japan, and introduces the cases of two universities that have successfully linked career education to university education in Japan.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: This paper deals with the problem of delay-dependent
stability for neural networks with distributed delays. Some new
sufficient condition are derived by constructing a novel
Lyapunov-Krasovskii functional approach. The criteria are
formulated in terms of a set of linear matrix inequalities, this is
convenient for numerically checking the system stability using the
powerful MATLAB LMI Toolbox. Moreover, in order to show the
stability condition in this paper gives much less conservative results
than those in the literature, numerical examples are considered.
Abstract: In recent years, geographic information systems (GIS)
and remote sensing using has increased to estimate runoff catchment.
In this research, runoff curve number maps for captive catchment of
Tehran by helping GIS and also remote sensing which based on
factors such as vegetation, lands using, group of soil hydrology and
hydrological conditions were obtained. Runoff curve numbers map
was obtained by combining these maps in ARC GIS and SCS table.
To evaluate the accuracy of the results, the maximum flow rate of
flood which was obtained from curve numbers, was compared with
the measured maximum flood rate at the watershed outlet and
correctness of curve numbers were approved.
Abstract: Effects of insertion of coiled wire in juxtaposition with twisted tapes on heat transfer rate and solar radiation without disturbing the flow inside the riser tubes in a solar flat plate collector is experimentally reconnoitered in this present work. The wire coil used as a turbulator is placed inside the riser tube while the twisted tape is inserted into the wire coil to create a continuous swirling flow along the tube wall. The results of the heat transfer have been compared well with the available results. The heat transfer rate in the collector has been found to be increased by 18% to 70%. Solar water heaters having inserts in the flow tubes perform better than the conventional plain ones. It has been observed that heat losses are reduced consequently increasing the thermal performance about 30% over the plain water heaters under the same operating conditions. The effect of twisted tape with wire coils, flow Reynolds number, and the intensity of solar radiation on the thermal performance of the solar water heater has been presented. Effects of insertion of coiled wire in juxtaposition with twisted tapes on heat transfer rate and solar radiation without disturbing the flow inside the riser tubes in a solar flat plate collector is experimentally reconnoitered in this present work. The wire coil used as a turbulator is placed inside the riser tube while the twisted tape is inserted into the wire coil to create a continuous swirling flow along the tube wall. The results of the heat transfer have been compared well with the available results. The heat transfer rate in the collector has been found to be increased by 18% to 70%. Solar water heaters having inserts in the flow tubes perform better than the conventional plain ones. It has been observed that heat losses are reduced consequently increasing the thermal performance about 30% over the plain water heaters under the same operating conditions. The effect of twisted tape with wire coils, flow Reynolds number, and the intensity of solar radiation on the thermal performance of the solar water heater has been presented.
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: High temperature is one of the most detrimental
effects that cause important changes in concrete’s mechanical,
physical, and thermo-physical properties. As a result of these
changes, especially high strength concrete (HSC), may exhibit
damages such as cracks and spallings. To overcome this problem,
incorporating polymer fibers such as polypropylene (PP) in concrete
is a very well-known method. In this study, using RRH, as a
sustainable material, instead of PP fiber in HSC to prevent spallings
and improve physical and thermo-physical properties were
investigated. Therefore, seven HSC mixtures with 0.25 water to
binder ratio were prepared incorporating silica fume and blast furnace
slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of
cement, respectively. All specimens were subjected to high
temperatures (20 (control), 300, 600 and 900˚C) with a heating rate
of 2.5˚C/min and after cooling, residual physical and thermo-physical
properties were determined.
Abstract: CNFET has emerged as an alternative material to
silicon for high performance, high stability and low power SRAM
design in recent years. SRAM functions as cache memory in
computers and many portable devices. In this paper, a new SRAM
cell design based on CNFET technology is proposed. The proposed
SRAM cell design for CNFET is compared with SRAM cell designs
implemented with the conventional CMOS and FinFET in terms of
speed, power consumption, stability, and leakage current. The
HSPICE simulation and analysis show that the dynamic power
consumption of the proposed 8T CNFET SRAM cell’s is reduced
about 48% and the SNM is widened up to 56% compared to the
conventional CMOS SRAM structure at the expense of 2% leakage
power and 3% write delay increase.
Abstract: The copyrights system is a combination of different elements. The number, content and the correlation of these elements are different for different legal orders. The models of copyrights systems display this system in terms of the interaction of economic and author's moral rights. Monistic and dualistic models are the most popular ones. The article deals with different points of view on the monism and dualism in copyright system. A specific model of the copyright in Switzerland in the XXth century is analyzed. The evolution of a French dualistic model of copyright is shown. The author believes that one should talk not about one, but rather about a number of dualism forms of copyright system.
Abstract: Localization of mobile robots are important tasks for
developing autonomous mobile robots. This paper proposes a method
to estimate positions of a mobile robot using a omnidirectional
camera on the robot. Landmarks for points of references are set
up on a field where the robot works. The omnidirectional camera
which can obtain 360 [deg] around images takes photographs of
these landmarks. The positions of the robots are estimated from
directions of these landmarks that are extracted from the images
by image processing. This method can obtain the robot positions
without accumulative position errors. Accuracy of the estimated
robot positions by the proposed method are evaluated through some
experiments. The results show that it can obtain the positions with
small standard deviations. Therefore the method has possibilities of
more accurate localization by tuning of appropriate offset parameters.
Abstract: A forecasting model for steel demand uncertainty in Thailand is proposed. It consists of trend, autocorrelation, and outliers in a hierarchical Bayesian frame work. The proposed model uses a cumulative Weibull distribution function, latent first-order autocorrelation, and binary selection, to account for trend, time-varying autocorrelation, and outliers, respectively. The Gibbs sampling Markov Chain Monte Carlo (MCMC) is used for parameter estimation. The proposed model is applied to steel demand index data in Thailand. The root mean square error (RMSE), mean absolute percentage error (MAPE), and mean absolute error (MAE) criteria are used for model comparison. The study reveals that the proposed model is more appropriate than the exponential smoothing method.