Abstract: This research proposes a novel reconstruction protocol
for restoring missing surfaces and low-quality edges and shapes in
photos of artifacts at historical sites. The protocol starts with the
extraction of a cloud of points. This extraction process is based on
four subordinate algorithms, which differ in the robustness and
amount of resultant. Moreover, they use different -but
complementary- accuracy to some related features and to the way
they build a quality mesh. The performance of our proposed protocol
is compared with other state-of-the-art algorithms and toolkits. The
statistical analysis shows that our algorithm significantly outperforms
its rivals in the resultant quality of its object files used to reconstruct
the desired model.
Abstract: A generalized vortex lattice method for complex
lifting surfaces with flap and aileron deflection is formulated. The
method is not restricted by the linearized theory assumption and
accounts for all standard geometric lifting surface parameters:
camber, taper, sweep, washout, dihedral, in addition to flap and
aileron deflection. Thickness is not accounted for since the physical
lifting body is replaced by a lattice of panels located on the mean
camber surface. This panel lattice setup and the treatment of different
wake geometries is what distinguish the present work form the
overwhelming majority of previous solutions based on the vortex
lattice method. A MATLAB code implementing the proposed
formulation is developed and validated by comparing our results to
existing experimental and numerical ones and good agreement is
demonstrated. It is then used to study the accuracy of the widely used
classical vortex-lattice method. It is shown that the classical approach
gives good agreement in the clean configuration but is off by as much
as 30% when a flap or aileron deflection of 30° is imposed. This
discrepancy is mainly due the linearized theory assumption
associated with the conventional method. A comparison of the effect
of four different wake geometries on the values of aerodynamic
coefficients was also carried out and it is found that the choice of the
wake shape had very little effect on the results.
Abstract: This study aimed at designing and developing a
mechanical force gauge for the square watermelon mold for the first
time. It also tried to introduce the square watermelon characteristics
and its production limitations. The mechanical force gauge
performance and the product itself were also described. There are
three main designable gauge models: a. hydraulic gauge, b. strain
gauge, and c. mechanical gauge. The advantage of the hydraulic
model is that it instantly displays the pressure and thus the force
exerted by the melon. However, considering the inability to measure
forces at all directions, complicated development, high cost, possible
hydraulic fluid leak into the fruit chamber and the possible influence
of increased ambient temperature on the fluid pressure, the
development of this gauge was overruled. The second choice was to
calculate pressure using the direct force a strain gauge. The main
advantage of these strain gauges over spring types is their high
precision in measurements; but with regard to the lack of conformity
of strain gauge working range with water melon growth, calculations
were faced with problems. Finally the mechanical pressure gauge has
advantages, including the ability to measured forces and pressures on
the mold surface during melon growth; the ability to display the peak
forces; the ability to produce melon growth graph thanks to its
continuous force measurements; the conformity of its manufacturing
materials with the required physical conditions of melon growth; high
air conditioning capability; the ability to permit sunlight reaches the
melon rind (no yellowish skin and quality loss); fast and
straightforward calibration; no damages to the product during
assembling and disassembling; visual check capability of the product
within the mold; applicable to all growth environments (field,
greenhouses, etc.); simple process; low costs and so forth.
Abstract: As currently various portable devices were launched,
smart business conducted using them became common. Since smart
business can use company-internal resources in an exlternal remote
place, user authentication that can identify authentic users is an
important factor. Commonly used user authentication is a method of
using user ID and Password. In the user authentication using ID and
Password, the user should see and enter authentication information
him or her. In this user authentication system depending on the user’s
vision, there is the threat of password leaks through snooping in the
process which the user enters his or her authentication information.
This study designed and produced a user authentication module
using an actuator to respond to the snooping threat.
Abstract: Recently, to cope with the rapidly changing
construction trend with aging infrastructures, modular bridge
technology has been studied actively. Modular bridge is easily
constructed by assembling standardized precast structure members in
the field. It will be possible to construct rapidly and reduce
construction cost efficiently. However, the shape of the transverse
connection of T-type girder newly developed between the segmented
modules is not verified. Therefore, the verification of the connection
shape is needed. In this study, shape of the modular T-girder bridge
transverse connection was analyzed by finite element model that was
verified in study which was verified model of transverse connection
using Abaqus. Connection angle was chosen as the parameter. The
result of analyses showed that optimal value of angle is 130 degree.
Abstract: Most flexible rotors can be considered as beam-like
structures. In many cases, rotors are modeled as one-dimensional
bodies, made basically of beam-like shafts with rigid bodies attached
to them. This approach is typical of rotor dynamics, both analytical
and numerical, and several rotor dynamic codes, based on the finite
element method, follow this trend. In this paper, a finite element
model based on Timoshenko beam elements is utilized to analyze the
lateral dynamic behavior of a certain rotor-bearing system in
operating conditions.
Abstract: In the present work, detailed analysis on flow characteristics of a pair of immiscible liquids through horizontal pipeline is simulated by using ANSYS FLUENT 6.2. Moderately viscous oil and water (viscosity ratio = 107, density ratio = 0.89 and interfacial tension = 0.024 N/m) have been taken as system fluids for the study. Volume of Fluid (VOF) method has been employed by assuming unsteady flow, immiscible liquid pair, constant liquid properties, and co-axial flow. Meshing has been done using GAMBIT. Quadrilateral mesh type has been chosen to account for the surface tension effect more accurately. From the grid independent study, we have selected 47037 number of mesh elements for the entire geometry. Simulation successfully predicts slug, stratified wavy, stratified mixed and annular flow, except dispersion of oil in water, and dispersion of water in oil. Simulation results are validated with horizontal literature data and good conformity is observed. Subsequently, we have simulated the hydrodynamics (viz., velocity profile, area average pressure across a cross section and volume fraction profile along the radius) of stratified wavy and annular flow at different phase velocities. The simulation results show that in the annular flow, total pressure of the mixture decreases with increase in oil velocity due to the fact that pipe cross section is completely wetted with water. Simulated oil volume fraction shows maximum at the centre in core annular flow, whereas, in stratified flow, maximum value appears at upper side of the pipeline. These results are in accord with the actual flow configuration. Our findings could be useful in designing pipeline for transportation of crude oil.
Abstract: This paper presents the electrical effect of two neighboring distribution substation during the construction phase. The size of auxiliary grounding grid have an effect on entire grounding system. The bigger the size of auxiliary grounding grid, the lower the GPR and maximum touch voltage, with the exception that when the two grids are unconnected, i.e. the bigger the size of auxiliary grounding grid, the higher the maximum step voltage. The results in this paper could be served as design guideline of grounding system, and perhaps remedy of some troublesome grounding grids in power distribution’s system. Modeling and simulation is carried out on the Current Distribution Electromagnetic interference Grounding and Soil structure (CDEGS) program. The simulation results exhibit the design and analysis of power system grounding and perhaps could be set as a standard in grounding system design and modification in distribution substations.
Abstract: Strontium hexaferrite (SrFe12O19; Sr-ferrite) is one of
the well-known materials for permanent magnets. In this study, Mtype
strontium ferrite was prepared by following the conventional
ceramic method from steelmaking by-product. Initial materials;
SrCO3 and by-product, were mixed together in the composition of
SrFe12O19 in different Sr/Fe ratios. The mixtures of these raw
materials were dry-milled for 6h. The blended powder was presintered
(i.e. calcination) at 1000°C for different times periods, then
cooled down to room temperature. These pre-sintered samples were
re-milled in a dry atmosphere for 1h and then fired at different
temperatures in atmospheric conditions, and cooled down to room
temperature. The produced magnetic powder has a dense hexagonal
grain shape structure. The calculated energy product values for the
produced samples ranged from 0.3 to 2.4 MGOe.
Abstract: The present environmental issues have made aircraft jet noise reduction a crucial problem in aero-acoustics research. Acoustic studies reveal that addition of chevrons to the nozzle reduces the sound pressure level reasonably with acceptable reduction in performance. In this paper comprehensive numerical studies on acoustic characteristics of different types of chevron nozzles have been carried out with non-reacting flows for the shape optimization of chevrons in supersonic nozzles for aerospace applications. The numerical studies have been carried out using a validated steady 3D density based, k-ε turbulence model. In this paper chevron with sharp edge, flat edge, round edge and U-type edge are selected for the jet acoustic characterization of supersonic nozzles. We observed that compared to the base model a case with round-shaped chevron nozzle could reduce 4.13% acoustic level with 0.6% thrust loss. We concluded that the prudent selection of the chevron shape will enable an appreciable reduction of the aircraft jet noise without compromising its overall performance. It is evident from the present numerical simulations that k-ε model can predict reasonably well the acoustic level of chevron supersonic nozzles for its shape optimization.
Abstract: When it comes to last, it is regarded as the critical foundation of shoe design and development. Not only the last relates to the comfort of shoes wearing but also it aids the production of shoe styling and manufacturing. In order to enhance the efficiency and application of last development, a computer aided methodology for customized last form designs is proposed in this study. The reverse engineering is mainly applied to the process of scanning for the last form. Then the minimum energy is used for the revision of surface continuity, the surface of the last is reconstructed with the feature curves of the scanned last. When the surface of a last is reconstructed, based on the foundation of the proposed last form reconstruction module, the weighted arithmetic mean method is applied to the calculation on the shape morphing which differs from the grading for the control mesh of last, and the algorithm of subdivision is used to create the surface of last mesh, thus the feet-fitting 3D last form of different sizes is generated from its original form feature with functions remained. Finally, the practicability of the proposed methodology is verified through later case studies.
Abstract: In the past, the most comprehensively adopted light
source was incandescent light bulbs, but with the appearance of LED
light sources, traditional light sources have been gradually replaced by
LEDs because of its numerous superior characteristics. However,
many of the standards do not apply to LEDs as the two light sources
are characterized differently. This also intensifies the significance of
studies on LEDs. As a Kansei design study investigating the visual
glare produced by traffic arrows implemented with LEDs, this study
conducted a semantic analysis on the styles of traffic arrows used in
domestic and international occasions. The results will be able to
reduce drivers’ misrecognition that results in the unsuccessful arrival
at the destination, or in traffic accidents. This study started with a
literature review and surveyed the status quo before conducting
experiments that were divided in two parts. The first part involved a
screening experiment of arrow samples, where cluster analysis was
conducted to choose five representative samples of LED displays. The
second part was a semantic experiment on the display of arrows using
LEDs, where the five representative samples and the selected ten
adjectives were incorporated. Analyzing the results with
Quantification Theory Type I, it was found that among the
composition of arrows, fletching was the most significant factor that
influenced the adjectives. In contrast, a “no fletching” design was
more abstract and vague. It lacked the ability to convey the intended
message and might bear psychological negative connotation including
“dangerous,” “forbidden,” and “unreliable.” The arrow design
consisting of “> shaped fletching” was found to be more concrete and
definite, showing positive connotation including “safe,” “cautious,”
and “reliable.” When a stimulus was placed at a farther distance, the
glare could be significantly reduced; moreover, the visual evaluation
scores would be higher. On the contrary, if the fletching and the shaft
had a similar proportion, looking at the stimuli caused higher
evaluation at a closer distance. The above results will be able to be
applied to the design of traffic arrows by conveying information
definitely and rapidly. In addition, drivers’ safety could be enhanced
by understanding the cause of glare and improving visual
recognizability.
Abstract: This research aimed to study on the efficiency of wastewater treatment by comparing the different aeration times of surface aerators in Suan Sunandha Rajabhat University. In doing so, the operation of surface aerators was divided into 2 groups which included the groups of 8 hours (8-0/opened-closed) and 4 hours (2-2/opened-closed) of aeration time per day. As a result of the study, it was found that the efficiency of wastewater treatment in the forms of DO, BOD, turbidity and NO2- by 8 hours (8-0/opened-closed) and 4 hours (2-2/opened-closed) of aeration time per day of surface aerators was not statistically different [Sig. = .644, .488, .716 and .054 > α (.05)] while the efficiency in the forms of NO3- and P was significantly different at the statistical level of .01 [Sig. = .001 and .000 < α (.01)].
Abstract: Prior literature on innovation diffusion or acceptance has almost exclusively concentrated on consumers’ positive attitudes and behaviors for new products/services. Consumers’ negative attitudes or behaviors to innovations have received relatively little marketing attention, but it happens frequently in practice. This study discusses consumer psychological factors when they try to learn or use new technologies. According to recent research, technological innovation acceptance has been considered as a dynamic or mediated process. This research argues that consumers can experience inertia and emotions in the initial use of new technologies. However, given such consumer psychology, the argument can be made as to whether the inclusion of consumer inertia (routine seeking and cognitive rigidity) and emotions increases the predictive power of new technology acceptance model. As data from the empirical study find, the process is potentially consumer emotion changing (independent of performance benefits) because of technology complexity and consumer inertia, and impact innovative technology use significantly. Finally, the study presents the superior predictability of the hypothesized model, which let managers can better predict and influence the successful diffusion of complex technological innovations.
Abstract: The sound pressure level (SPL) of the moving-coil
loudspeaker (MCL) is often simulated and analyzed using the lumped
parameter model. However, the SPL of a MCL cannot be simulated
precisely in the high frequency region, because the value of cone
effective area is changed due to the geometry variation in different
mode shapes, it is also related to affect the acoustic radiation mass and
resistance. Herein, the paper presents the inverse method which has a
high ability to measure the value of cone effective area in various
frequency points, also can estimate the MCL electroacoustic
parameters simultaneously. The proposed inverse method comprises
the direct problem, adjoint problem, and sensitivity problem in
collaboration with nonlinear conjugate gradient method. Estimated
values from the inverse method are validated experimentally which
compared with the measured SPL curve result. Results presented in
this paper not only improve the accuracy of lumped parameter model
but also provide the valuable information on loudspeaker cone design.
Abstract: Solid lipid nanoparticles (SLNs) have gained great attention for the topical treatment of skin associated fungal infection as they facilitate the skin penetration of loaded drugs. Our work deals with the preparation of nystatin loaded solid lipid nanoparticles (NystSLNs) using the hot homogenization and ultrasonication method. The prepared NystSLNs were characterized in terms of entrapment efficiency, particle size, zeta potential, transmission electron microscopy, differential scanning calorimetry, rheological behavior and in vitro drug release. A stability study for 6 months was performed. A microbiological study was conducted in male rats infected with Candida albicans, by counting the colonies and examining the histopathological changes induced on the skin of infected rats. The results showed that SLNs dispersions are spherical in shape with particle size ranging from 83.26±11.33 to 955.04±1.09 nm. The entrapment efficiencies are ranging from 19.73±1.21 to 72.46±0.66% with zeta potential ranging from -18.9 to -38.8 mV and shear-thinning rheological Behavior. The stability studies done for 6 months showed that nystatin (Nyst) is a good candidate for topical SLN formulations. A least number of colony forming unit/ ml (cfu/ml) was recorded for the selected NystSLN compared to the drug solution and the commercial Nystatin® cream present in the market. It can be fulfilled from this work that SLNs provide a good skin targeting effect and may represent promising carrier for topical delivery of Nyst offering the sustained release and maintaining the localized effect, resulting in an effective treatment of cutaneous fungal infection.
Abstract: Effect of blockage ratio on heat transfer from non-circular tube is studied experimentally. For doing this experiment a suction type low speed wind tunnel with test section dimension of 14×14×40 and velocity in rage of 7-20 m/s was designed. The blockage ratios varied between 1.5 to 7 and Reynolds number based on equivalent diameter varies in range of 7.5×103 to 17.5×103. The results show that by increasing blockage ratio from 1.5 to 7, drag coefficient of the cam shaped tube decreased about 55 percent. By increasing Reynolds number, Nusselt number of the cam shaped tube increases about 40 to 48 percent in all ranges of blockage ratios.
Abstract: Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.