Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: Japanese society is experiencing an aging population and declining birth rate along with the popularization of higher education, spread of economic globalization, rapid progress in technical innovation, changes in employment conditions, and emergence of a knowledge-based society. Against this background, interest in career education at Japanese universities has increased in recent years. This paper describes how the government has implemented career education policies in Japan, and introduces the cases of two universities that have successfully linked career education to university education in Japan.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: In recent years, geographic information systems (GIS)
and remote sensing using has increased to estimate runoff catchment.
In this research, runoff curve number maps for captive catchment of
Tehran by helping GIS and also remote sensing which based on
factors such as vegetation, lands using, group of soil hydrology and
hydrological conditions were obtained. Runoff curve numbers map
was obtained by combining these maps in ARC GIS and SCS table.
To evaluate the accuracy of the results, the maximum flow rate of
flood which was obtained from curve numbers, was compared with
the measured maximum flood rate at the watershed outlet and
correctness of curve numbers were approved.
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: This study compared the mechanical and microstructural properties produced during friction stir welding (FSW) of S275 structural steel in air and underwater. Post weld tests assessed the tensile strength, micro-hardness, distortion, Charpy impact toughness and fatigue performance in each case. The study showed that there was no significant difference in the strength, hardness or fatigue life of the air and underwater specimens. However, Charpy impact toughness was shown to decrease for the underwater specimens and was attributed to a lower degree of recrystallization caused by the higher rate of heat loss experienced when welding underwater. Reduced angular and longitudinal distortion was observed in the underwater welded plate compared to the plate welded in air.
Abstract: The semiconductor industry is placing an increased
emphasis on emerging materials and devices that may provide
improved performance, or provide novel functionality for devices.
Recently, graphene, as a true two-dimensional carbon material, has
shown fascinating applications in electronics. In this paper detailed
discussions are introduced for possible applications of grapheme
Transistor in RF and digital devices.
Abstract: Purpose: This E-survey was carried out to facilitate the implementation and Education of VMAT (Volumetric Modulated Arc Therapy) in Radiotherapy-RT departments and reasons for not using IMRT (Intensity Modulated Radiotherapy). VMAT Skills in demand were also identified. Method: E-Survey was distributed to NHS hospitals across UK by email. Thirty NHS and related centres in England, 21 in Scotland, 3 in Ireland and 1 in Wales were contacted. This Survey was intended for those working in RT and Medical Physics and who were responsible for Treatment Planning and training. Results: This E-survey have indicated pathways adopted by staff to acquire VMAT skills, strategies to efficiently implement VMAT in RT departments and for obtaining VMAT Education. Conclusion: Despite poor survey response this survey has managed to highlight requirements for education and implementation of VMAT that are also applicable to IMRT. Other RT centres in world can also find these results useful.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: Outrigger-braced wall systems are commonly used to provide high rise buildings with the required lateral stiffness for wind and earthquake resistance. The existence of outriggers adds to the stiffness and strength of walls as reported by several studies. The effects of different parameters on the elasto-plastic dynamic behavior of outrigger-braced wall systems to earthquakes are investigated in this study. Parameters investigated include outrigger stiffness, concrete strength, and reinforcement arrangement as the main design parameters in wall design. In addition to being significantly affect the wall behavior, such parameters may lead to the change of failure mode and the delay of crack propagation and consequently failure as the wall is excited by earthquakes. Bi-linear stress-strain relation for concrete with limited tensile strength and truss members with bi-linear stress-strain relation for reinforcement were used in the finite element analysis of the problem. The famous earthquake record, El-Centro, 1940 is used in the study. Emphasize was given to the lateral drift, normal stresses and crack pattern as behavior controlling determinants. Results indicated significant effect of the studied parameters such that stiffer outrigger, higher grade concrete and concentrating the reinforcement at wall edges enhance the behavior of the system. Concrete stresses and cracking behavior are too much enhanced while less drift improvements are observed.
Abstract: There are several types of metal-based devices conceived as dampers for the seismic energy absorber whereby damages to the major structural components could be minimized for both new and existing structures. This paper aimed to develop and evaluate structural performance of slit circular shear panel damper for passive seismic energy protection by inelastic deformation. Structural evaluation was done using commercially available nonlinear FE simulation program. The main parameters considered are: diameter-to-thickness (D/t) ratio and slit length-to-width ratio (l/w). Depending on these parameters three different buckling mode and hysteretic behavior was found: yielding prior to buckling without strength degradation, yielding prior to buckling with strength degradation and yielding with buckling and strength degradation which forms pinching at initial displacement. The susceptible location at which the possible crack is initiated is also identified for selected specimens using rupture index.
Abstract: Social media refers to the means of interactions
among people in which they create share, exchange and comment
contents among themselves in virtual communities and networks.
Social media or "social networking" has almost become part of our
daily lives and being tossed around over the past few years. It is like
any other media such as newspaper, radio and television but it is far
more than just about sharing information and ideas. Social
networking tools like Twitter, Facebook, Flickr and Blogs have
facilitated creation and exchange of ideas so quickly and widely than
the conventional media. This paper shows the choices,
communication, feeling comfort, time saving and effects of social
media among the people.
Abstract: In this paper the design, fabrication, and testing of a miniaturized rectangular microstrip patch antenna loaded with DNG metamaterials is reported. The metamaterial is composed of two nested spiral strips and a single straight strip which are etched on two sides of a 5.7 mm×5.7 mm Rogers RT/duroid 5880 with 0.5 mm thickness and dielectric constant of 2.2. Two units of this structure as a double negative (DNG) medium in combination with air as a double positive (DPS) medium are used as substrate of the microstrip patch antenna. By placing these metamaterial structures under the patch, a sub-wavelength resonance occurs which leads to a smaller size patch antenna compared to the conventional antenna at that frequency. The total size of the proposed antenna is reduced 54.6%. The dimensions of the proposed patch antenna are significantly smaller than the wavelength of the operation frequency with respect to the conventional patch antenna. Simulation result and test result for the proposed patch antenna are given and compared.
Abstract: Object detection using Wavelet Neural Network (WNN) plays a major contribution in the analysis of image processing. Existing cluster-based algorithm for co-saliency object detection performs the work on the multiple images. The co-saliency detection results are not desirable to handle the multi scale image objects in WNN. Existing Super Resolution (SR) scheme for landmark images identifies the corresponding regions in the images and reduces the mismatching rate. But the Structure-aware matching criterion is not paying attention to detect multiple regions in SR images and fail to enhance the result percentage of object detection. To detect the objects in the high-resolution remote sensing images, Tagged Grid Matching (TGM) technique is proposed in this paper. TGM technique consists of the three main components such as object determination, object searching and object verification in WNN. Initially, object determination in TGM technique specifies the position and size of objects in the current image. The specification of the position and size using the hierarchical grid easily determines the multiple objects. Second component, object searching in TGM technique is carried out using the cross-point searching. The cross out searching point of the objects is selected to faster the searching process and reduces the detection time. Final component performs the object verification process in TGM technique for identifying (i.e.,) detecting the dissimilarity of objects in the current frame. The verification process matches the search result grid points with the stored grid points to easily detect the objects using the Gabor wavelet Transform. The implementation of TGM technique offers a significant improvement on the multi-object detection rate, processing time, precision factor and detection accuracy level.
Abstract: Lately, with the increasing number of location-based applications, demand for highly accurate and reliable indoor localization became urgent. This is a challenging problem, due to the measurement variance which is the consequence of various factors like obstacles, equipment properties and environmental changes in complex nature of indoor environments. In this paper we propose low-cost custom-setup infrastructure solution and localization algorithm based on the Weighted Centroid Localization (WCL) method. Localization accuracy is increased by several enhancements: calibration of RSSI values gained from wireless nodes, repetitive measurements of RSSI to exclude deviating values from the position estimation, and by considering orientation of the device according to the wireless nodes. We conducted several experiments to evaluate the proposed algorithm. High accuracy of ~1m was achieved.
Abstract: An investigation of adaptable winglets for morphing
aircraft control and performance is described in this paper. The
concepts investigated consist of various winglet configurations
fundamentally centred on a baseline swept wing. The impetus for the
work was to identify and optimize winglets to enhance controllability
and the aerodynamic efficiency of a small unmanned aerial vehicle.
All computations were performed with Athena Vortex Lattice
modelling with varying degrees of twist, swept, and dihedral angle
considered. The results from this work indicate that if adaptable
winglets were employed on small scale UAV’s improvements in both
aircraft control and performance could be achieved.
Abstract: A Jet-stream airsail concept takes advantage of aerology
in order to fly without propulsion. Weather phenomena, especially jet
streams, are relatively permanent high winds blowing from west to
east, located at average altitudes and latitudes in both hemispheres.
To continuously extract energy from the jet-stream, the system is
composed of a propelled plane and a wind turbine interconnected by
a cable. This work presents the aerodynamic characteristics and the
behavior of the cable that links the two subsystems and transmits
energy from the turbine to the aircraft. Two ways of solving this
problem are explored: numerically and analytically. After obtaining
the optimal shape of the cross-section of the cable, its behavior
is analyzed as a 2D problem solved numerically and analytically.
Finally, a 3D extension could be considered by adding lateral forces.
The results of this work can be further used in the design process of
the overall system: aircraft-turbine.
Abstract: The design of an optimised horizontal axis 5-meter-long wind turbine rotor blade in according with IEC 61400-2 standard is a research and development project in order to fulfil the requirements of high efficiency of torque from wind production and to optimise the structural components to the lightest and strongest way possible. For this purpose, a research study is presented here by focusing on the structural characteristics of a composite wind turbine blade via finite element modelling and analysis tools. In this work, first, the required data regarding the general geometrical parts are gathered. Then, the airfoil geometries are created at various sections along the span of the blade by using CATIA software to obtain the two surfaces, namely; the suction and the pressure side of the blade in which there is a hat shaped fibre reinforced plastic spar beam, so-called chassis starting at 0.5m from the root of the blade and extends up to 4 m and filled with a foam core. The root part connecting the blade to the main rotor differential metallic hub having twelve hollow threaded studs is then modelled. The materials are assigned as two different types of glass fabrics, polymeric foam core material and the steel-balsa wood combination for the root connection parts. The glass fabrics are applied using hand wet lay-up lamination with epoxy resin as METYX L600E10C-0, is the unidirectional continuous fibres and METYX XL800E10F having a tri-axial architecture with fibres in the 0,+45,-45 degree orientations in a ratio of 2:1:1. Divinycell H45 is used as the polymeric foam. The finite element modelling of the blade is performed via MSC PATRAN software with various meshes created on each structural part considering shell type for all surface geometries, and lumped mass were added to simulate extra adhesive locations. For the static analysis, the boundary conditions are assigned as fixed at the root through aforementioned bolts, where for dynamic analysis both fixed-free and free-free boundary conditions are made. By also taking the mesh independency into account, MSC NASTRAN is used as a solver for both analyses. The static analysis aims the tip deflection of the blade under its own weight and the dynamic analysis comprises normal mode dynamic analysis performed in order to obtain the natural frequencies and corresponding mode shapes focusing the first five in and out-of-plane bending and the torsional modes of the blade. The analyses results of this study are then used as a benchmark prior to modal testing, where the experiments over the produced wind turbine rotor blade has approved the analytical calculations.