Abstract: Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: The Montreal protocol and Kyoto protocol underlined the need of substitution of CFC’s and HCFC’s due to their adverse impact on atmospheric ozone layer which protects earth from U.V rays. The CFCs have been entirely ruled out since 1995 and a long-term basis HCFCs must be replaced by 2020. All this events motivated HFC refrigerants which are harmless to ozone layer. In this paper thermodynamic analysis of cascade refrigeration system has been done using three different refrigerant pairs R13-R12, R290-R23, and R404A-R23. Effect of various operating parameters i.e. evaporator temperature, condenser temperature, temperature difference in cascade condenser and low temperature cycle condenser temperature on performance parameters viz. COP, exergetic efficiency and refrigerant mass flow ratio have been studied. Thermodynamic analysis shows that out of three refrigerant pairs R12-R13, R290-R23 and R404A-R23 the COP of R290-R23 refrigerant pair is highest.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: This paper deals with the problem of delay-dependent
stability for neural networks with distributed delays. Some new
sufficient condition are derived by constructing a novel
Lyapunov-Krasovskii functional approach. The criteria are
formulated in terms of a set of linear matrix inequalities, this is
convenient for numerically checking the system stability using the
powerful MATLAB LMI Toolbox. Moreover, in order to show the
stability condition in this paper gives much less conservative results
than those in the literature, numerical examples are considered.
Abstract: In recent years, geographic information systems (GIS)
and remote sensing using has increased to estimate runoff catchment.
In this research, runoff curve number maps for captive catchment of
Tehran by helping GIS and also remote sensing which based on
factors such as vegetation, lands using, group of soil hydrology and
hydrological conditions were obtained. Runoff curve numbers map
was obtained by combining these maps in ARC GIS and SCS table.
To evaluate the accuracy of the results, the maximum flow rate of
flood which was obtained from curve numbers, was compared with
the measured maximum flood rate at the watershed outlet and
correctness of curve numbers were approved.
Abstract: Effects of insertion of coiled wire in juxtaposition with twisted tapes on heat transfer rate and solar radiation without disturbing the flow inside the riser tubes in a solar flat plate collector is experimentally reconnoitered in this present work. The wire coil used as a turbulator is placed inside the riser tube while the twisted tape is inserted into the wire coil to create a continuous swirling flow along the tube wall. The results of the heat transfer have been compared well with the available results. The heat transfer rate in the collector has been found to be increased by 18% to 70%. Solar water heaters having inserts in the flow tubes perform better than the conventional plain ones. It has been observed that heat losses are reduced consequently increasing the thermal performance about 30% over the plain water heaters under the same operating conditions. The effect of twisted tape with wire coils, flow Reynolds number, and the intensity of solar radiation on the thermal performance of the solar water heater has been presented. Effects of insertion of coiled wire in juxtaposition with twisted tapes on heat transfer rate and solar radiation without disturbing the flow inside the riser tubes in a solar flat plate collector is experimentally reconnoitered in this present work. The wire coil used as a turbulator is placed inside the riser tube while the twisted tape is inserted into the wire coil to create a continuous swirling flow along the tube wall. The results of the heat transfer have been compared well with the available results. The heat transfer rate in the collector has been found to be increased by 18% to 70%. Solar water heaters having inserts in the flow tubes perform better than the conventional plain ones. It has been observed that heat losses are reduced consequently increasing the thermal performance about 30% over the plain water heaters under the same operating conditions. The effect of twisted tape with wire coils, flow Reynolds number, and the intensity of solar radiation on the thermal performance of the solar water heater has been presented.
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: High temperature is one of the most detrimental
effects that cause important changes in concrete’s mechanical,
physical, and thermo-physical properties. As a result of these
changes, especially high strength concrete (HSC), may exhibit
damages such as cracks and spallings. To overcome this problem,
incorporating polymer fibers such as polypropylene (PP) in concrete
is a very well-known method. In this study, using RRH, as a
sustainable material, instead of PP fiber in HSC to prevent spallings
and improve physical and thermo-physical properties were
investigated. Therefore, seven HSC mixtures with 0.25 water to
binder ratio were prepared incorporating silica fume and blast furnace
slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of
cement, respectively. All specimens were subjected to high
temperatures (20 (control), 300, 600 and 900˚C) with a heating rate
of 2.5˚C/min and after cooling, residual physical and thermo-physical
properties were determined.
Abstract: CNFET has emerged as an alternative material to
silicon for high performance, high stability and low power SRAM
design in recent years. SRAM functions as cache memory in
computers and many portable devices. In this paper, a new SRAM
cell design based on CNFET technology is proposed. The proposed
SRAM cell design for CNFET is compared with SRAM cell designs
implemented with the conventional CMOS and FinFET in terms of
speed, power consumption, stability, and leakage current. The
HSPICE simulation and analysis show that the dynamic power
consumption of the proposed 8T CNFET SRAM cell’s is reduced
about 48% and the SNM is widened up to 56% compared to the
conventional CMOS SRAM structure at the expense of 2% leakage
power and 3% write delay increase.
Abstract: The copyrights system is a combination of different elements. The number, content and the correlation of these elements are different for different legal orders. The models of copyrights systems display this system in terms of the interaction of economic and author's moral rights. Monistic and dualistic models are the most popular ones. The article deals with different points of view on the monism and dualism in copyright system. A specific model of the copyright in Switzerland in the XXth century is analyzed. The evolution of a French dualistic model of copyright is shown. The author believes that one should talk not about one, but rather about a number of dualism forms of copyright system.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: Outrigger-braced wall systems are commonly used to provide high rise buildings with the required lateral stiffness for wind and earthquake resistance. The existence of outriggers adds to the stiffness and strength of walls as reported by several studies. The effects of different parameters on the elasto-plastic dynamic behavior of outrigger-braced wall systems to earthquakes are investigated in this study. Parameters investigated include outrigger stiffness, concrete strength, and reinforcement arrangement as the main design parameters in wall design. In addition to being significantly affect the wall behavior, such parameters may lead to the change of failure mode and the delay of crack propagation and consequently failure as the wall is excited by earthquakes. Bi-linear stress-strain relation for concrete with limited tensile strength and truss members with bi-linear stress-strain relation for reinforcement were used in the finite element analysis of the problem. The famous earthquake record, El-Centro, 1940 is used in the study. Emphasize was given to the lateral drift, normal stresses and crack pattern as behavior controlling determinants. Results indicated significant effect of the studied parameters such that stiffer outrigger, higher grade concrete and concentrating the reinforcement at wall edges enhance the behavior of the system. Concrete stresses and cracking behavior are too much enhanced while less drift improvements are observed.
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: Object detection using Wavelet Neural Network (WNN) plays a major contribution in the analysis of image processing. Existing cluster-based algorithm for co-saliency object detection performs the work on the multiple images. The co-saliency detection results are not desirable to handle the multi scale image objects in WNN. Existing Super Resolution (SR) scheme for landmark images identifies the corresponding regions in the images and reduces the mismatching rate. But the Structure-aware matching criterion is not paying attention to detect multiple regions in SR images and fail to enhance the result percentage of object detection. To detect the objects in the high-resolution remote sensing images, Tagged Grid Matching (TGM) technique is proposed in this paper. TGM technique consists of the three main components such as object determination, object searching and object verification in WNN. Initially, object determination in TGM technique specifies the position and size of objects in the current image. The specification of the position and size using the hierarchical grid easily determines the multiple objects. Second component, object searching in TGM technique is carried out using the cross-point searching. The cross out searching point of the objects is selected to faster the searching process and reduces the detection time. Final component performs the object verification process in TGM technique for identifying (i.e.,) detecting the dissimilarity of objects in the current frame. The verification process matches the search result grid points with the stored grid points to easily detect the objects using the Gabor wavelet Transform. The implementation of TGM technique offers a significant improvement on the multi-object detection rate, processing time, precision factor and detection accuracy level.
Abstract: A Jet-stream airsail concept takes advantage of aerology
in order to fly without propulsion. Weather phenomena, especially jet
streams, are relatively permanent high winds blowing from west to
east, located at average altitudes and latitudes in both hemispheres.
To continuously extract energy from the jet-stream, the system is
composed of a propelled plane and a wind turbine interconnected by
a cable. This work presents the aerodynamic characteristics and the
behavior of the cable that links the two subsystems and transmits
energy from the turbine to the aircraft. Two ways of solving this
problem are explored: numerically and analytically. After obtaining
the optimal shape of the cross-section of the cable, its behavior
is analyzed as a 2D problem solved numerically and analytically.
Finally, a 3D extension could be considered by adding lateral forces.
The results of this work can be further used in the design process of
the overall system: aircraft-turbine.
Abstract: In this paper a nonlinear feedback control called augmented automatic choosing control (AACC) for a class of
nonlinear systems with constrained input is presented. When designed
the control, a constant term which arises from linearization of a
given nonlinear system is treated as a coefficient of a stable zero
dynamics. Parameters of the control are suboptimally selected by
maximizing the stable region in the sense of Lyapunov with the aid
of a genetic algorithm. This approach is applied to a field excitation
control problem of power system to demonstrate the splendidness
of the AACC. Simulation results show that the new controller can
improve performance remarkably well.
Abstract: Small and medium-sized enterprises (SME) are the backbone of central Europe’s economies and have a significant contribution to the gross domestic product. Production planning and scheduling (PPS) is still a crucial element in manufacturing industries of the 21st century even though this area of research is more than a century old. The topic of PPS is well researched especially in the context of large enterprises in the manufacturing industry. However the implementation of PPS methodologies within SME is mostly unobserved. This work analyzes how PPS is implemented in SME with the geographical focus on Switzerland and its vicinity. Based on restricted resources compared to large enterprises, SME have to face different challenges. The real problem areas of selected enterprises in regards of PPS are identified and evaluated. For the identified real-life problem areas of SME clear and detailed recommendations are created, covering concepts and best practices and the efficient usage of PPS. Furthermore the economic and entrepreneurial value for companies is lined out and why the implementation of the introduced recommendations is advised.