Abstract: A novel new vanadium (IV) complexes incorporating the chelating diamido cyclopentadienyl {ArN(CH2)3NAr)}2-((ηn-Cp)Cp)} (Ar = 2,6-Pri2C6H3)(Cp = C5H5 and n = 1,2,3,4 and 5) have been studied with calculation of the properties of species involved in various of cyclopentadienyl reaction. These were carried out under investigation of density functional theory (DFT) calculation, and comparing together. Other methods, explicitly including electron correlation, are necessary for more accurate calculations; MB3LYP (Becke) (Lee–Yang–Parr) level of theory often being used to obtain more exact results. These complexes were estimated of electronic energy for molecular system, because it accounts for all electron correlation interactions.
The optimised of [V(ArN(CH2)3NAr)2Cl(η5-Cp)] (Ar = 2,6-Pri2C6H3 and Cp= C5H5) was found to be thermally more stable than others of vanadium cyclopentadienyl. In the meantime the complex [V(ArN(CH2)3NAr)2Cl(η1-Cp)] (Ar = 2,6-Pri2C6H3 and Cp= C5H5) which is showed a low thermal stability in case of the just one carbon of cyclopentadienyl can be insertion with vanadium metal centre. By using Dewar-Chatt-Duncanson model, as a basis of the molecular orbital (MO) analysis and showed the highest occupied molecular orbital (HOMO) and lowest occupied molecular orbital LUMO.
Abstract: This investigation develops a revisable method for estimating the estimate value of equivalent 10 Hz voltage flicker (DV10) of a DC Electric Arc Furnace (EAF). This study also discusses three 161kV DC EAFs by field measurement, with those results indicating that the estimated DV10 value is significantly smaller than the survey value. The key point is that the conventional means of estimating DV10 is inappropriate. There is a main cause as the assumed Qmax is too small.
Although DC EAF is regularly operated in a constant MVA mode, the reactive power variation in the Main Transformer (MT) is more significant than that in the Furnace Transformer (FT). A substantial difference exists between estimated maximum reactive power fluctuation (DQmax) and the survey value from actual DC EAF operations. However, this study proposes a revisable method that can obtain a more accurate DV10 estimate than the conventional method.
Abstract: The rapid development and growth of technology has changed the method of obtaining information for educators and learners. Technology has created a new world of collaboration and communication among people. Incorporating new technology into the teaching process can enhance learning outcomes. Billions of individuals across the world are now connected together, and are cooperating and contributing their knowledge and intelligence. Time is no longer wasted in waiting until the teacher is ready to share information as learners can go online and get it immediatelt.
The objectives of this paper are to understand the reasons why changes in teaching and learning methods are necessary, to find ways of improving them, and to investigate the challenges that present themselves in the adoption of new ICT tools in higher education institutes.
To achieve these objectives two primary research methods were used: questionnaires, which were distributed among students at higher educational institutes and multiple interviews with faculty members (teachers) from different colleges and universities, which were conducted to find out why teaching and learning methodology should change.
The findings show that both learners and educators agree that educational technology plays a significant role in enhancing instructors’ teaching style and students’ overall learning experience; however, time constraints, privacy issues, and not being provided with enough up-to-date technology do create some challenges.
Abstract: As an emerging business model, cloud computing has been initiated to satisfy the need of organizations and to push Information Technology as a utility. The shift to the cloud has changed the way Information Technology departments are managed traditionally and has raised many concerns for both, public and private sectors.
The purpose of this study is to investigate the possibility of cloud computing services replacing services provided traditionally by IT departments. Therefore, it aims to 1) explore whether organizations in Oman are ready to move to the cloud; 2) identify the deciding factors leading to the adoption or rejection of cloud computing services in Oman; and 3) provide two case studies, one for a successful Cloud provider and another for a successful adopter.
This paper is based on multiple research methods including conducting a set of interviews with cloud service providers and current cloud users in Oman; and collecting data using questionnaires from experts in the field and potential users of cloud services.
Despite the limitation of bandwidth capacity and Internet coverage offered in Oman that create a challenge in adopting the cloud, it was found that many information technology professionals are encouraged to move to the cloud while few are resistant to change.
The recent launch of a new Omani cloud service provider and the entrance of other international cloud service providers in the Omani market make this research extremely valuable as it aims to provide real-life experience as well as two case studies on the successful provision of cloud services and the successful adoption of these services.
Abstract: Effect of blockage ratio on heat transfer from non-circular tube is studied experimentally. For doing this experiment a suction type low speed wind tunnel with test section dimension of 14×14×40 and velocity in rage of 7-20 m/s was designed. The blockage ratios varied between 1.5 to 7 and Reynolds number based on equivalent diameter varies in range of 7.5×103 to 17.5×103. The results show that by increasing blockage ratio from 1.5 to 7, drag coefficient of the cam shaped tube decreased about 55 percent. By increasing Reynolds number, Nusselt number of the cam shaped tube increases about 40 to 48 percent in all ranges of blockage ratios.
Abstract: Since women obtained the right to vote in 1893 for the first time in New Zealand, they have tried to participate actively into politics but still the world has a few women in political leadership. The article asks which factors might influence the appearance of women leadership in politics. The article investigates two factors such as political context, personal factors. Countries where economic development is stable and political democracy is consolidated have a tendency of appearance of women political leadership but in less developed and politically unstable countries, women politicians can be in power with their own reasons. For the personal factor, their feminist propensity is studied but there is no relationship between the appearance of women leaders and their feminist propensity.
Abstract: Ferulic acid has widespread industrial potential by virtue of its antioxidant properties. However, it is partially soluble in aqueous media, limiting their usefulness in oil-based processes in food, cosmetic, pharmaceutical, and material industry. Therefore, modification of ferulic acid should be made by producing of more lipophilic derivatives. In this study, a preliminary investigation of lipase-catalyzed trans-esterification reaction of ethyl ferulate and olive oil was investigated. The reaction was catalyzed by immobilized lipase from Candida antarctica (Novozym 435), to produce ferulate ester, a sunscreen agent. A statistical approach of Response surface methodology (RSM) was used to evaluate the interactive effects of reaction temperature (40-80°C), reaction time (4-12 hours), and amount of enzyme (0.1-0.5 g). The optimum conditions derived via RSM were reaction temperature 60°C, reaction time 2.34 hours, and amount of enzyme 0.3 g. The actual experimental yield was 59.6% ferulate ester under optimum condition, which compared well to the maximum predicted value of 58.0%.
Abstract: The purpose of this study was to investigate the relationships among leisure motivation, leisure attitude, and health promotion lifestyle. The participants were recruited from a convenience sampling that subjects were at least 55 years of age in Tainan City, Taiwan. Three hundred survey instruments were distributed, and 227 effective instruments were returned, for an effective rate of 75.7%. The collected data were analyzed statistically. The findings of this research were as follows: 1.There is significantly correlated between leisure motivation and leisure attitude. 2. There is significantly correlated between leisure attitude and health promotion lifestyle. 3. There is significantly correlated between leisure motivation and health promotion lifestyle.
Abstract: Polymer composite nano-fibers including (1, 3 wt %)
silver nano-particles have been produced by electrospinning method.
Polyacrylonitrile/N,N-dimethylformamide (PAN/DMF) solution have
been prepared and the amount of silver nitrate have been adjusted to
PAN weight. Silver nano-particles were obtained from reduction of
silver ions into silver nano-particles by chemical reduction by
hydrazine hydroxide (N2H5OH). The different amount of silver salt
was loaded into polymer matrix to obtain polyacrylonitrile composite
nano-fiber containing silver nano-particles. The effect of the amount
of silver nano-particles on the properties of composite nano-fiber web
was investigated. Electrical conductivity, mechanical properties,
thermal properties were examined by Microtest LCR Meter 6370
(0.01 mΩ-100 MΩ), Tensile tester, Differential scanning calorimeter
DSC (Q10) and SEM respectively. Also antimicrobial efficiency test
(ASTM E2149-10) was done against to Staphylococcus aureus
bacteria. It has been seen that breaking strength, conductivity,
antimicrobial effect, enthalpy during cyclization increase by use of
silver nano-particles while the diameter of nano-fiber decreases.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: The objectives of this study is to investigate the impact
of culture on advertising appeals in mobile phone industry via social
media channel in UK, Brazil and India. Content analysis on Samsung
and Nokia commercials in YouTube is conducted. The result
indicates that the advertising appeals are both congruent and
incongruent with cultural dimensions in UK, Brazil and India. The
result suggests that Hofstede and value paradoxes might be the tools
to predict the relationship between cultural values and advertising
appeals.
Abstract: Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This paper is aimed to investigate farmers’ level of awareness and behavior of chemical pesticide uses, by using a case study of Suan Luang Sub- District Municipality, Ampawa, Samut Songkram Province. Questionnaire was employed in this study with the farmers from 46 households to explore their level of awareness in chemical pesticide uses, while interview and observation were adopted in exploring their behavior of chemical pesticide uses. The findings reflected the farmers’ high level of awareness in chemical pesticide uses in the hazardous effects of the chemical to human and environmental health, while their behavior of chemical pesticide uses explained their awareness paid to the right way of using pesticides, for instance reading the direction on the label, keeping children and animals away from the area of pesticide mixing, covering body with clothes and wearing hat and mask, no smoking, eating or drinking during pesticide spray or standing in windward direction.
Abstract: We installed solar panels and digital meteorological equipments whose electrical power is supplied using PV on July 13, 2011. Then, the relationship between the electric power generation and the irradiation, air temperature, and wind velocity was investigated on a roof at a university. The electrical power generation, irradiation, air temperature, and wind velocity were monitored over two years. By analyzing the measured meteorological data and electric power generation data using PTC, we calculated the size of the solar panel that is most suitable for this system. We also calculated the wasted power generation using PTC with the measured meteorological data obtained in this study. In conclusion, to reduce the "wasted power generation", a smaller-size solar panel is required for stable operation.
Abstract: In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem. Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA).
Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: High temperature is one of the most detrimental
effects that cause important changes in concrete’s mechanical,
physical, and thermo-physical properties. As a result of these
changes, especially high strength concrete (HSC), may exhibit
damages such as cracks and spallings. To overcome this problem,
incorporating polymer fibers such as polypropylene (PP) in concrete
is a very well-known method. In this study, using RRH, as a
sustainable material, instead of PP fiber in HSC to prevent spallings
and improve physical and thermo-physical properties were
investigated. Therefore, seven HSC mixtures with 0.25 water to
binder ratio were prepared incorporating silica fume and blast furnace
slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of
cement, respectively. All specimens were subjected to high
temperatures (20 (control), 300, 600 and 900˚C) with a heating rate
of 2.5˚C/min and after cooling, residual physical and thermo-physical
properties were determined.