Abstract: Sustainable urban waterfront development is one of the
most interesting phenomena of urban renewal in the last decades.
However, there are still many cities whose visual image is
compromised due to the lack of a sustainable urban waterfront
development, which consequently affects the place of those cities
globally. This paper aims to reimagine the role of waterfront areas in
city design, with a particular focus on Egypt, so that they provide
attractive, sustainable urban environments while promoting the
continued aesthetic development of the city overall. This aim will be
achieved by determining the main principles of a sustainable urban
waterfront and its applications. This paper concentrates on
sustainability assessment rating systems. A number of international
case-studies, wherein a city has applied the basic principles for a
sustainable urban waterfront and have made use of sustainability
assessment rating systems, have been selected as examples which can
be applied to the urban waterfronts in Egypt. This paper establishes the
importance of developing the design of urban environments in Egypt,
as well as identifying the methods of sustainability application for
urban waterfronts.
Abstract: Solid lipid nanoparticles (SLNs) have gained great attention for the topical treatment of skin associated fungal infection as they facilitate the skin penetration of loaded drugs. Our work deals with the preparation of nystatin loaded solid lipid nanoparticles (NystSLNs) using the hot homogenization and ultrasonication method. The prepared NystSLNs were characterized in terms of entrapment efficiency, particle size, zeta potential, transmission electron microscopy, differential scanning calorimetry, rheological behavior and in vitro drug release. A stability study for 6 months was performed. A microbiological study was conducted in male rats infected with Candida albicans, by counting the colonies and examining the histopathological changes induced on the skin of infected rats. The results showed that SLNs dispersions are spherical in shape with particle size ranging from 83.26±11.33 to 955.04±1.09 nm. The entrapment efficiencies are ranging from 19.73±1.21 to 72.46±0.66% with zeta potential ranging from -18.9 to -38.8 mV and shear-thinning rheological Behavior. The stability studies done for 6 months showed that nystatin (Nyst) is a good candidate for topical SLN formulations. A least number of colony forming unit/ ml (cfu/ml) was recorded for the selected NystSLN compared to the drug solution and the commercial Nystatin® cream present in the market. It can be fulfilled from this work that SLNs provide a good skin targeting effect and may represent promising carrier for topical delivery of Nyst offering the sustained release and maintaining the localized effect, resulting in an effective treatment of cutaneous fungal infection.
Abstract: Chittagong is the commercial capital of Bangladesh.
Here Agrabad is one of the most commercial activity centers of
Chittagong. Due to many light industry and commercial land use,
Agrabad to CEPZ road at Agrabad is the only major road of
Chittagong port city which encompasses a huge number of vehicles
every day. It has many junctions which distribute traffic flow in
different roads. In these junctions vehicles gather at some conflict
point to create traffic jam and make the performance of the road
downward. This study is parallel focused on the existing level of
service with traffic volume, capacity, and speed by traffic survey.
After all of these analyses the performance of the road is determined
with finding the factors that influences the performance.
Abstract: In this paper, the design of a coaxial feed single layer rectangular microstrip patch antenna for three different wireless communication band applications is presented. The proposed antenna is designed by using substrate Roger RT/duroid 5880 having permittivity of about 2.2 and tangent loss of 0.0009. The characteristics of the substrate are designed and to evaluate the performance of modeled antenna using HFSS v.11 EM simulator, from Ansoft. The proposed antenna has small in size and operates at 2.25GHz, 3.76GHz and 5.23GHz suitable for mobile satellite service (MSS) network, WiMAX and WLAN applications. The dimension of the patch and slots are optimized to obtain these desired functional frequency ranges. The simulation results with frequency response, radiation pattern and return loss, VSWR, Input Impedance are presented with appropriate table and graph.
Abstract: With the advances in information and communications technology, mobile context-aware applications have become powerful marketing tools. In Apple online store, there are numerous mobile applications (APPs) developed for destination tour. This study investigated the determinants of adoption of context-aware APPs for destination tour services. A model is proposed based on Technology Acceptance Model and privacy concern theory. The model was empirically tested based on a sample of 259 users of a tourism APP published by Kaohsiung Tourism Bureau, Taiwan. The results showed that the fitness of the model is well and, among all the factors, the perceived usefulness and perceived ease of use have the most significant influences on the intention to adopt context-aware destination APPs. Finally, contrary to the findings of previous literature, the effect of privacy concern on the adoption intention of context-aware APP is insignificant.
Abstract: Biomass is renewable and sustainable. As an energy source, it will not release extra carbon dioxide into the atmosphere. Hence, tremendous efforts have been made to develop technologies capable of transforming biomass into suitable forms of bio-fuel. One of the viable technologies is gasifying biomass in supercritical water (SCW), a green medium for reactions. While previous studies overwhelmingly selected glucose as a model compound for biomass, the present study adopted fructose for the sake of comparison. The gasification of fructose in SCW was investigated experimentally to evaluate the applicability of supercritical water processes to biomass gasification. Experiments were conducted with an autoclave reactor. Gaseous product mainly consists of H2, CO, CO2, CH4 and C2H6. The effect of two major operating parameters, the reaction temperature (673-873 K) and the dosage of oxidizing agent (0-0.5 stoichiometric oxygen), on the product gas composition, yield and heating value was also examined, with the reaction pressure fixed at 25 MPa.
Abstract: This paper presents the findings from a numerical simulation of the flow in 37-rod fuel assembly models spaced by a double-wire trapezoidal wrapping as applied to the BREST-OD-300 experimental nuclear reactor. Data on a high static pressure distribution within the models, and equations for determining the fuel bundle flow friction factors have been obtained. Recommendations are provided on using the closing turbulence models available in the ANSYS Fluent. A comparative analysis has been performed against the existing empirical equations for determining the flow friction factors. The calculated and experimental data fit has been shown.
An analysis into the experimental data and results of the numerical simulation of the BREST-OD-300 fuel rod assembly hydrodynamic performance are presented.
Abstract: DC-DC converters are widely used as reliable power source for many industrial and military applications, computers and electronic devices. Several control methods were developed for DC-DC converters control mostly with asymptotic convergence. Synergetic control (SC) is a proven robust control approach and will be used here in a so called terminal scheme to achieve finite time convergence. Lyapounov synthesis is adopted to assure controlled system stability. Furthermore particle swarm optimization (PSO) algorithm, based on an integral time absolute of error (ITAE) criterion will be used to optimize controller parameters. Simulation of terminal synergetic control of a DC-DC converter is carried out for different operating conditions and results are compared to classic synergetic control performance, that which demonstrate the effectiveness and feasibility of the proposed control method.
Abstract: Cloud virtualization technologies are becoming more
and more prevalent, cloud users usually encounter the problem of how
to access to the virtualized remote desktops easily over the web
without requiring the installation of special clients. To resolve this
issue, we took advantage of the HTML5 technology and developed
web-based remote desktop. It permits users to access the terminal
which running in our cloud platform from anywhere. We implemented
a sketch of web interface following the cloud computing concept that
seeks to enable collaboration and communication among users for
high performance computing. Given the development of remote
desktop virtualization, it allows to shift the user’s desktop from the
traditional PC environment to the cloud platform, which is stored on a
remote virtual machine rather than locally. This proposed effort has
the potential to positively provide an efficient, resilience and elastic
environment for online cloud service. This is also made possible by the
low administrative costs as well as relatively inexpensive end-user
terminals and reduced energy expenses.
Abstract: The extracellular proteins secreted by bacteria may be increased in stressful surroundings, such as in the presence of antibiotics. It appears that many antibiotics, when used at low concentrations, have in common the ability to activate or repress gene transcription, which is distinct from their inhibitory effect. There have been comparatively few studies on the potential of antibiotics as a specific chemical signal that can trigger a variety of biological functions. Therefore, this study was carried out to determine the effect of Streptomycin Sulfate in regulating extracellular proteins secreted by Bacillus subtilis ATCC21332. Results of Microdilution assay showed that the Minimum Inhibition Concentration (MIC) of Streptomycin Sulfate on B. subtilis ATCC21332 was 2.5 mg/ml. The bacteria cells were then exposed to Streptomycin Sulfate at concentration of 0.01 MIC before being further incubated for 48h to 72 h. The extracellular proteins secreted were then isolated and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins profile revealed that three additional bands with approximate sizes of 30 kDa, 22 kDa and 23 kDa were appeared for the treated bacteria with Streptomycin Sulfate. Thus, B. subtilis ATCC21332 in stressful condition with the presence of Streptomycin Sulfate at low concentration could induce the extracellular proteins secretion.
Abstract: Blood gamma irradiation is the only available method
to prevent transfusion associated graft versus host disease (TAGVHD).
However, when blood is irradiated, determine blood shelf
time is crucial. Non irradiated blood have a self-time from 21 to 35
days when is preserved with anticoagulated solution and stored at
4°C. During their storage, red blood cells (RBC) undergo a series of
biochemical, biomechanical and molecular changes involving what is
known as storage lesion (SL). SL include loss of structural integrity
of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and
increase of both ion potassium concentration and hemoglobin (Hb).
On the other hand, Atomic force Microscopy (AFM) represents a
versatile tool for a nano-scale high resolution topographic analysis in
biological systems. In order to evaluate SL in irradiated and nonirradiated
blood, RBC topography and morphometric parameters
were obtained from an AFM XE-BIO system. Cell viability was
followed using flow cytometry. Our results showed that early
markers as nanoscale roughness, allow us to evaluate blood quality
since other perspective.
Abstract: Water is a fundamental attraction in all cultures and among all classes of people,tourists and citizens. It is a favorite location for major tourism initiatives, celebrations and ceremonies. The vitality of any city depends on citizen action to take part in creating the neighborhoods they desire. Waterfront can provide extensive new areas of high quality public open space in parts of the city that are popular venues for social activities and also have the highest land values. Each city must have a character that can be used as a key attraction for the development. The morphology of a waterfront can be identified by both its physical characteristics and the socio-cultural activities that take place in the area. Alexandria has been selected as an area of study because it has a unique character due to its possession of a variety of waterfronts.
This paper aims to set some criteria of successful waterfront development and then through these criteria analyzing the development of the Qaitbay waterfront in the eastern harbor in Alexandria, Egypt. Hence, a comprehensive improvement of the waterfront areas is certainly needed to ensure a successful waterfront development radiated the sense of uniformity and coherence.
Alexandria can benefit from these criteria to develop its urban waterfront in order to preserve and revitalize its unique waterfront character and achieve mixed uses and tourism development.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: There have been a lot of efforts and researches undertaken in developing efficient tools for performing several tasks in data mining. Due to the massive amount of information embedded in huge data warehouses maintained in several domains, the extraction of meaningful pattern is no longer feasible. This issue turns to be more obligatory for developing several tools in data mining. Furthermore the major aspire of data mining software is to build a resourceful predictive or descriptive model for handling large amount of information more efficiently and user friendly. Data mining mainly contracts with excessive collection of data that inflicts huge rigorous computational constraints. These out coming challenges lead to the emergence of powerful data mining technologies. In this survey a diverse collection of data mining tools are exemplified and also contrasted with the salient features and performance behavior of each tool.
Abstract: In recent years, many researchers are involved in the
field of fuzzy theory. However, there are still a lot of issues to be
resolved. Especially on topics related to controller design such as the
field of robot, artificial intelligence, and nonlinear systems etc.
Besides fuzzy theory, algorithms in swarm intelligence are also a
popular field for the researchers. In this paper, a concept of utilizing
one of the swarm intelligence method, which is called Bacterial-GA
Foraging, to find the stabilized common P matrix for the fuzzy
controller system is proposed. An example is given in in the paper, as
well.
Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.