Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: High temperature is one of the most detrimental
effects that cause important changes in concrete’s mechanical,
physical, and thermo-physical properties. As a result of these
changes, especially high strength concrete (HSC), may exhibit
damages such as cracks and spallings. To overcome this problem,
incorporating polymer fibers such as polypropylene (PP) in concrete
is a very well-known method. In this study, using RRH, as a
sustainable material, instead of PP fiber in HSC to prevent spallings
and improve physical and thermo-physical properties were
investigated. Therefore, seven HSC mixtures with 0.25 water to
binder ratio were prepared incorporating silica fume and blast furnace
slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of
cement, respectively. All specimens were subjected to high
temperatures (20 (control), 300, 600 and 900˚C) with a heating rate
of 2.5˚C/min and after cooling, residual physical and thermo-physical
properties were determined.
Abstract: Object detection using Wavelet Neural Network (WNN) plays a major contribution in the analysis of image processing. Existing cluster-based algorithm for co-saliency object detection performs the work on the multiple images. The co-saliency detection results are not desirable to handle the multi scale image objects in WNN. Existing Super Resolution (SR) scheme for landmark images identifies the corresponding regions in the images and reduces the mismatching rate. But the Structure-aware matching criterion is not paying attention to detect multiple regions in SR images and fail to enhance the result percentage of object detection. To detect the objects in the high-resolution remote sensing images, Tagged Grid Matching (TGM) technique is proposed in this paper. TGM technique consists of the three main components such as object determination, object searching and object verification in WNN. Initially, object determination in TGM technique specifies the position and size of objects in the current image. The specification of the position and size using the hierarchical grid easily determines the multiple objects. Second component, object searching in TGM technique is carried out using the cross-point searching. The cross out searching point of the objects is selected to faster the searching process and reduces the detection time. Final component performs the object verification process in TGM technique for identifying (i.e.,) detecting the dissimilarity of objects in the current frame. The verification process matches the search result grid points with the stored grid points to easily detect the objects using the Gabor wavelet Transform. The implementation of TGM technique offers a significant improvement on the multi-object detection rate, processing time, precision factor and detection accuracy level.
Abstract: The aim of this work is to analyze a viscous flow
around the axisymmetric blunt body taken into account the mesh size
both in the free stream and into the boundary layer. The resolution of
the Navier-Stokes equations is realized by using the finite volume
method to determine the flow parameters and detached shock
position. The numerical technique uses the Flux Vector Splitting
method of Van Leer. Here, adequate time stepping parameter, CFL
coefficient and mesh size level are selected to ensure numerical
convergence. The effect of the mesh size is significant on the shear
stress and velocity profile. The best solution is obtained with using a
very fine grid. This study enabled us to confirm that the
determination of boundary layer thickness can be obtained only if the
size of the mesh is lower than a certain value limits given by our
calculations.
Abstract: The research studied and examined the
competitiveness of the animation industry in Thailand. Data were
collected based on articles, related reports and websites, news,
research, and interviews of key persons from both public and private
sectors. The diamond model was used to analyze the study. The
major factor driving the Thai animation industry forward includes a
quality workforce, their creativity and strong associations. However,
discontinuity in government support, infrastructure, marketing, IP
creation and financial constraints were factors keeping the Thai
animation industry less competitive in the global market.
Abstract: In this paper we deal with using Lego Mindstorms in
simulation of robotic systems with respect to cost reduction. Lego
Mindstorms kit contains broad variety of hardware components
which are required to simulate, program and test the robotics systems
in practice. Algorithm programming went in development
environment supplied together with Lego kit as in programming
language C# as well. Algorithm following the line, which we dealt
with in this paper, uses theoretical findings from area of controlling
circuits. PID controller has been chosen as controlling circuit whose
individual components were experimentally adjusted for optimal
motion of robot tracking the line. Data which are determined to
process by algorithm are collected by sensors which scan the
interface between black and white surfaces followed by robot. Based
on discovered facts Lego Mindstorms can be considered for low-cost
and capable kit to simulate real robotics systems.
Abstract: This paper presents breast cancer detection by
observing the specific absorption rate (SAR) intensity for
identification tumor location, the tumor is identified in coordinates
(x,y,z) system. We examined the frequency between 4-8 GHz to look
for the most appropriate frequency. Results are simulated in
frequency 4-8 GHz, the model overview include normal breast with
50 mm radian, 5 mm diameter of tumor, and ultra wideband (UWB)
bowtie antenna. The models are created and simulated in CST
Microwave Studio. For this simulation, we changed antenna to 5
location around the breast, the tumor can be detected when an
antenna is close to the tumor location, which the coordinate of
maximum SAR is approximated the tumor location. For reliable, we
experiment by random tumor location to 3 position in the same size
of tumor and simulation the result again by varying the antenna
position in 5 position again, and it also detectable the tumor position
from the antenna that nearby tumor position by maximum value of
SAR, which it can be detected the tumor with precision in all
frequency between 4-8 GHz.
Abstract: This study examines whether the Taiwan’s public debt is sustainable utilizing an unrestricted two-regime threshold autoregressive (TAR) model with an autoregressive unit root. The empirical results show that Taiwan’s public debt appears as a nonlinear series and is stationary in regime 1 but not in regime 2. This result implies that while Taiwan’s public debt was mostly sustainable over the 1996 to 2013 period examined in the study, it may no longer be sustainable in the most recent two years as the public debt ratio has increased cumulatively to 3.618%.
Abstract: Power, responsibility sharing, and democratic decision-making are the central ethos to co-management. It is assumed that involving local community in the decision-making process can create a sense of ownership and responsibility of that community and motivate the community towards collective action. But this paper demonstrated that the process to involve local community is not simple and straightforward as it is influenced by structural aspects, power relations among the actors, and social embedded institutions. These factors shape the process in that way who will participate, how they will participate and how the local community maneuvers their agency in the decision-making process. To grasp the complexities that materialize in the process of participation and to understand the inclusionary and exclusionary nature of participation, this paper examines the subjective understanding of different stakeholders concerning participation and furthermore observes the enabling or constraining factors that affect the community to exercise their agency.
Abstract: Indoor wireless localization systems have played an
important role to enhance context-aware services. Determining the
position of mobile objects in complex indoor environments, such as
those in multi-floor buildings, is very challenging problems. This
paper presents an effective floor estimation algorithm, which can
accurately determine the floor where mobile objects located. The
proposed algorithm is based on the confidence interval of the
summation of online Received Signal Strength (RSS) obtained from
the IEEE 802.15.4 Wireless Sensor Networks (WSN).We compare
the performance of the proposed algorithm with those of other floor
estimation algorithms in literature by conducting a real
implementation of WSN in our facility. The experimental results and
analysis showed that the proposed floor estimation algorithm
outperformed the other algorithms and provided highest percentage
of floor accuracy up to 100% with 95-percent confidence interval.
Abstract: This research paper was aimed to examine the relationship between visitors’ attitude towards the service marketing mix and visitors’ frequency of visit to Bangpu Recreation Centre. Based on a large and uncalculated population, the number of samples was calculated according to the formula to obtain a total of 385 samples. In collecting the samples, systematic random sampling was applied and by using of a Likert five-scale questionnaire for, a total of 21 days to collect the needed information. Mean, Standard Deviation, and Pearson’s basic statistical correlations were utilized in analyzing the data. This study discovered a high level of visitors’ attitude product and service of Bangpu Recreation Centre, price, place, promotional activities, people who provided service and physical evidence of the centre. The attitude towards process of service was discovered to be at a medium level. Additionally, the finding of an examination of a relationship between visitors’ attitude towards service marketing mix and visitors’ frequency of visit to Bangpu Recreation Centre presented that product and service, people, physical evidence and process of service provision showed a relationship with the visitors’ frequency of visit to the centre per year.
Abstract: The objectives of this project are to study on the work
efficiency of the employees, sorted by their profiles, and to study on
the relation between job attributes and work efficiency of employees
of Suan Sunandha Rajabhat University. The samples used for this
study are 292 employees. The statistics used in this study are
frequencies, standard deviations, One-way ANOVA and Pearson’s
correlation coefficient. Majority of respondent were male with an
undergraduate degree, married and lives together. The average age of
respondents was between 31-41 years old, married and the
educational background are higher than bachelor’s degree. The job
attribute is correlated to the work efficiency with the statistical
significance level of.o1. This concurs with the predetermined
hypothesis. The correlation between the two main factors is in the
moderate level. All the categories of job attributes such as the variety
of skills, job clarity, job importance, freedom to do work are
considered separately.
Abstract: We used 24 Ile de France lambs, weighing between 15 and 32 kg (BW). Treatments were supplemented with concentrate: “in nature” sugarcane (IN), sugarcane hydrolyzed using 0.6% calcium oxide (CaO) under aerobic condition (AER), and sugarcane hydrolyzed using 0.6% CaO under anaerobic condition (ANA), constituting a completely randomized design with eight repetitions per treatment. Lambs were housed in individual stalls and fed into the through, allowing 10% of leftovers. Lambs were slaughtered when body weight reached 32 kg. The following parameters were determined on Longissimu lumborum muscle of hot and cold carcasses: pH and color, 45 minutes and 24 hours after slaughtering. Qualitative analysis of the meat were performed in the loins, water-holding capacity (WHC), cooking loss (CL), and shear force (SF). We used a completely randomized design with three treatments and eight repetitions. Means were compared by Tukey test at 5% significance. A higher value for redness (a*) 45 minutes after slaughter (10.48) were found for lambs fed hydrolyzed under anaerobic conditions sugarcane. The other qualitative characteristics of meat were not affected by treatments (P >0.05). The comparison of meat quality resulting from the treatments shows that it is possible to feed in nature sugarcane to lambs, thus waiving hydrolyses process and the spending with alkalizing agent.
Abstract: The aim of the current research was to determine
quality parameters changes of dried venison during storage. Protein,
fat and moisture content dynamics as well microbiological quality
was analyzed. For the experiments the meat (0.02×4.00×7.00 cm)
pieces were marinated in “teriyaki sauce” marinade (composition:
teriyaki sauce, sweet and sour sauce, taco sauce, soy sauce, American
BBQ sauce hickory, sesame oil, garlic, garlic salt, tabasco red pepper
sauce) at 4±2°C temperature for 48±1h. Sodium monophosphate
(E339) was also added in part of marinade to improve the meat
textural properties. After marinating, meat samples were dried in
microwave-vacuum drier MUSSON–1, packaged in vacuum pouches
made from polymer film (PA/PE) with barrier properties and storage
for 4 months at 18±1°C temperature in dark place. Dried venison
samples were analyzed after 0, 35, 91 and 112 days of storage.
During the storage total plate counts of dried venison samples
significantly (p
Abstract: This paper provides an analysis of the insurance cycle in the Republic of Croatia and whether they are affected by catastrophic losses on a global level. In general, it is considered that insurance cycles are particularly pronounced in periods of financial crisis, but are also affected by the growing number of catastrophic losses. They cause the change of insurance cycle and premium growth and intensification and narrowing of the coverage conditions, so these variables move in the same direction and these phenomena point to a new cycle. The main goal of this paper is to determine the existence of insurance cycle in the Republic of Croatia and investigate whether catastrophic losses have an influence on insurance cycles.
Abstract: The linguistic competence of Thai university students majoring in Business English was examined in the context of knowledge of English language inflection, and also various linguistic elements. Errors analysis was applied to the results of the testing. Levels of errors in inflection, tense and linguistic elements were shown to be significantly high for all noun, verb and adjective inflections. Findings suggest that students do not gain linguistic competence in their use of English language inflection, because of interlanguage interference. Implications for curriculum reform and treatment of errors in the classroom are discussed.
Abstract: Lawsone is a pigment that occurs naturally in plants.
It has been used as a skin and hair dye for a long time. Moreover, its
different biological activities have been reported. The present study
focused on the effect of lawsone on a plant cell model represented by
tobacco BY-2 cell suspension culture, which is used as a model
comparable with the HeLa cells. It has been shown that lawsone
inhibits the cell growth in the concentration-dependent manner. In
addition, changes in DNA methylation level have been determined.
We observed decreasing level of DNA methylation in the presence of
increasing concentrations of lawsone. These results were
accompanied with overproduction of reactive oxygen species (ROS).
Since epigenetic modifications can be caused by different stress
factors, there could be a connection between the changes in the level
of DNA methylation and ROS production caused by lawsone.
Abstract: The purpose of this paper was to examine views of
secondary school science teachers about purposes to use practical
works in school science. The instrument to survey consisted eighteen
items, which were categorized into four components as follows:
‘Scientific inquiry’, ‘Scientific knowledge’, ‘Science-related attitude’,
and ‘STS (science-technology-society)’. Subjects were 152 secondary
school science teachers (male 70 and female 82; middle school 50 and
high school 102), who are teaching in 42 schools of 8 provinces. On
the survey, science teachers were asked to answer on 5-point Lickert
scale (from 1 to 5) how they thought of using practical works on
purposes with domains of science objectives in school. They had
positive views about using practical works for improving scientific
inquiry process skills, science-related attitudes, and perceptions about
STS literacy, and acquiring scientific knowledge. They would have the
most willingness of using practical works for ‘Scientific Inquiry’
among domains of science objectives in school.
Abstract: Microalgae due to the ability to accumulate high levels of practically valuable polyunsaturated fatty acids attract attention as a promising raw material for commercial products. The features of the growth processes of cells green protococcal microalgae Oocystis rhomboideus, Scenedesmus obliquus, Dictyochlorella globosa at cultivation in different nutritional mediums were determined. For the rapid accumulation of biomass, combined with high productivity of total lipids fraction yield recommended to use the Fitzgerald medium (Scenodesmus obliquus, Oocystis rhomboideus) and/or Bold medium (Dictyochlorella globosa). Productivity of lipids decreased in sequence Dictyochlorella globosa > Scenodesmus obliquus > Oocystis rhomboideus. The bulk of fatty acids fraction of the total lipids is unsaturated fatty acids, which accounts for 70 to 83% of the total number of fatty acids. The share of monoenic acids accounts from 18 to 34%, while the share of unsaturated fatty acids - from 44 to 62% of the total number of unsaturated fatty acids fraction. Among the unsaturated acids dominate α-linolenic acid (C18:3n-3), hexadecatetraenic acid (C16:4) and linoleic acid (C18:2).