Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: Farmers are in need of regular and relevant information relating to new technologies. Production of extension materials has been found to be useful in facilitating the process. Extension materials help to provide information to reach large numbers of farmers quickly and economically. However, as good as extension materials are, previous materials produced are not used by farmers. The reasons for this include lack of involvement of farmers in the production of the extension materials, most of the extension materials are not relevant to the farmers’ environments, the agricultural extension agents lack capacity to prepare the materials, and many extension agents lack commitment. These problems led to this innovative capacity building of extension agents. This innovative approach involves five stages. The first stage is the diagnostic survey of farmers’ environment to collect useful information. The second stage is the development and production of draft extension materials. The third stage is the field testing and evaluation of draft materials by the same famers that were involved at the diagnostic stage. The fourth stage is the revision of the draft extension materials by incorporating suggestions from farmers. The fifth stage is the action plans. This process improves the capacity of agricultural extension agents in the preparation of extension materials and also promotes engagement of farmers and beneficiaries in the process. The process also makes farmers assume some level of ownership of the exercise and the extension materials.
Abstract: There are several types of metal-based devices conceived as dampers for the seismic energy absorber whereby damages to the major structural components could be minimized for both new and existing structures. This paper aimed to develop and evaluate structural performance of slit circular shear panel damper for passive seismic energy protection by inelastic deformation. Structural evaluation was done using commercially available nonlinear FE simulation program. The main parameters considered are: diameter-to-thickness (D/t) ratio and slit length-to-width ratio (l/w). Depending on these parameters three different buckling mode and hysteretic behavior was found: yielding prior to buckling without strength degradation, yielding prior to buckling with strength degradation and yielding with buckling and strength degradation which forms pinching at initial displacement. The susceptible location at which the possible crack is initiated is also identified for selected specimens using rupture index.
Abstract: The design of an optimised horizontal axis 5-meter-long wind turbine rotor blade in according with IEC 61400-2 standard is a research and development project in order to fulfil the requirements of high efficiency of torque from wind production and to optimise the structural components to the lightest and strongest way possible. For this purpose, a research study is presented here by focusing on the structural characteristics of a composite wind turbine blade via finite element modelling and analysis tools. In this work, first, the required data regarding the general geometrical parts are gathered. Then, the airfoil geometries are created at various sections along the span of the blade by using CATIA software to obtain the two surfaces, namely; the suction and the pressure side of the blade in which there is a hat shaped fibre reinforced plastic spar beam, so-called chassis starting at 0.5m from the root of the blade and extends up to 4 m and filled with a foam core. The root part connecting the blade to the main rotor differential metallic hub having twelve hollow threaded studs is then modelled. The materials are assigned as two different types of glass fabrics, polymeric foam core material and the steel-balsa wood combination for the root connection parts. The glass fabrics are applied using hand wet lay-up lamination with epoxy resin as METYX L600E10C-0, is the unidirectional continuous fibres and METYX XL800E10F having a tri-axial architecture with fibres in the 0,+45,-45 degree orientations in a ratio of 2:1:1. Divinycell H45 is used as the polymeric foam. The finite element modelling of the blade is performed via MSC PATRAN software with various meshes created on each structural part considering shell type for all surface geometries, and lumped mass were added to simulate extra adhesive locations. For the static analysis, the boundary conditions are assigned as fixed at the root through aforementioned bolts, where for dynamic analysis both fixed-free and free-free boundary conditions are made. By also taking the mesh independency into account, MSC NASTRAN is used as a solver for both analyses. The static analysis aims the tip deflection of the blade under its own weight and the dynamic analysis comprises normal mode dynamic analysis performed in order to obtain the natural frequencies and corresponding mode shapes focusing the first five in and out-of-plane bending and the torsional modes of the blade. The analyses results of this study are then used as a benchmark prior to modal testing, where the experiments over the produced wind turbine rotor blade has approved the analytical calculations.
Abstract: The focus of this paper is to compare common approaches for Systems of Innovation (SI) and identify proactive alternatives for driving the innovation. Proactive approaches will also consider short and medium term perspectives with developments in the field of Computer Technology and Artificial Intelligence. Concerning Computer Technology and Large Connected Information Systems, it is reasonable to predict that during current or the next century intelligence and innovation will be separated from the constraints of human driven management. After this happens, humans will be no longer driving the innovation and there is possibility that SI for new intelligent systems will set its own targets and exclude humans. Over long time scale these developments could result in scenario, which will lead to the development of larger, cross galactic (universal) proactive SI and Intelligence.
Abstract: Experimental Film Class Project is supported by the Institute for Research and Development at Suan Sunandha Rajabhat University. This project is purported to provide academic and professional services to improve the quality standards of the community and locals in accordance with the mission of the university, which is to improve and expand knowledge for the community and to develop and transfer such knowledge and professions to the next generation. Eventually, it leads to sustainable development because the development of human resources is deemed as the key for sustainable development. Moreover, the Experimental Film Class is an integral part of the teaching of film production at Suan Sunandha International School of Art (SISA). By means of giving opportunities to students for participation in projects by sharing experience, skill and knowledge and participation in field activities, it helps students in the film production major to enhance their abilities and potentials as preparation for their readiness in the marketplace. Additionally, in this class, we provide basic film knowledge, screenwriting techniques, editing and subtitles including uploading videos on social media such as YouTube and Facebook for the participant students.
Abstract: In this paper we deal with using Lego Mindstorms in
simulation of robotic systems with respect to cost reduction. Lego
Mindstorms kit contains broad variety of hardware components
which are required to simulate, program and test the robotics systems
in practice. Algorithm programming went in development
environment supplied together with Lego kit as in programming
language C# as well. Algorithm following the line, which we dealt
with in this paper, uses theoretical findings from area of controlling
circuits. PID controller has been chosen as controlling circuit whose
individual components were experimentally adjusted for optimal
motion of robot tracking the line. Data which are determined to
process by algorithm are collected by sensors which scan the
interface between black and white surfaces followed by robot. Based
on discovered facts Lego Mindstorms can be considered for low-cost
and capable kit to simulate real robotics systems.
Abstract: One of the main biomedical problem lies in detecting dependencies in semi structured data. Solution includes biomedical portal and algorithms (integral rating health criteria, multidimensional data visualization methods). Biomedical portal allows to process diagnostic and research data in parallel mode using Microsoft System Center 2012, Windows HPC Server cloud technologies. Service does not allow user to see internal calculations instead it provides practical interface. When data is sent for processing user may track status of task and will achieve results as soon as computation is completed. Service includes own algorithms and allows diagnosing and predicating medical cases. Approved methods are based on complex system entropy methods, algorithms for determining the energy patterns of development and trajectory models of biological systems and logical–probabilistic approach with the blurring of images.
Abstract: The objective of presenting this article is to analyze between Thai’s film and Thai society in political crisis, to study the development and trend of the film which reflects society in Thailand from political crisis of 14 October 1973 and the present day political crisis using a comparative study of the two era, both the similarities and differences in the film reflects the society in an era of change.
Abstract: This study was aimed to investigate the effect of
various organic supplements on growth and development of
Dendrobium discolor’s protocorms and seedlings growth of
Dendrobium Judy Rutz. Protocorms of Dendrobium discolor with 2.0
cm. in diameter and seedlings of Dendrobium Judy Rutz at the same
size (0.5 cm. height) were sub-cultured on Hyponex medium
supplemented with cow milk (CM), soy milk (SM), potato extract
(PE) and peptone (P) for 2 months. The protocorms were developed
to seedlings in all treatments after cultured for 2 months. However,
the best results were found on Hyponex medium supplemented with
P was the best in which the maximum fresh and dry weight and
maximum shoot height were obtained in this treatment statistically
different (p ≤ 0.05) to other treatments. Moreover, Hyponex medium
supplemented with P also stimulated the maximum mean number of
5.7 shoots per explant which also showed statistically different (p ≤
0.05) when compared to other treatments. The results of growth of
Dendrobium Judy Rutz seedlings indicated the medium
supplemented with 100 mL/L PE enhanced the maximum fresh and
dry weigh per explants with significantly different (p ≤ 0.05) in fresh
weight from other treatments including the control medium without
any organic supplementation. However, the dry weight was not
significantly different (p ≤ 0.05) from medium supplemented with
SM and P. There was multiple shoots induction in all media with or
without organic supplementation ranging from 2.6 to 3 shoots per
explants. The maximum shoot height was also obtained in the
seedlings cultured on medium supplemented with PE while the
longest root length was found in medium supplemented with SM.
Abstract: This research aims to create a knowledge-based system as a database for self-healthcare analysis, diagnosis of simple illnesses, and the use of Thai herbs instead of modern medicine by using principles of Thai traditional medication theory. These were disseminated by website network programs within Suan Sunandha Rajabhat University. The population used in this study was divided into two groups: the first group consisted of four experts of Thai traditional medication and the second group was 300 website users. The methods used for collecting data were paper questionnaires and poll questionnaires on the website. The statistics used for analyzing data was at an average level. The results were divided into three parts: the first part was the development of a knowledge-based system and the second part was applied programs on website. Both parts could be fulfilled and achieved according to the set goal. The third part was the evaluation of the study: The evaluation of the viewpoints of the experts towards website designs were evaluated at a good level of 4.20. The satisfaction evaluation of the users was found at a good level of average satisfactory level at 4.24. It was found that the young population of those under the age of 16 had less cares about their health than the population of other teenagers, working age adults and those of older age. The research findings should be extended in order to encourage the lifestyle modifications to people of all ages by using the self-healthcare principles.
Abstract: Biopharmaceuticals manufacturing is one of the major economic activities worldwide. Ninety-three percent of the workforce in a biomanufacturing environment concentrates in production-related areas. As a result, strategic collaborations between industry and academia are crucial to ensure the availability of knowledgeable workforce needed in an economic region to become competitive in biomanufacturing. In the past decade, our institution has been a key strategic partner with multinational biotechnology companies in supplying science and engineering graduates in the field of industrial biotechnology. Initiatives addressing all levels of the educational pipeline, from K-12 to college to continued education for company employees have been established along a ten-year span. The Amgen BioTalents Program was designed to provide undergraduate science and engineering students with training in biomanufacturing. The areas targeted by this educational program enhance their academic development, since these topics are not part of their traditional science and engineering curricula. The educational curriculum involved the process of producing a biomolecule from the genetic engineering of cells to the production of an especially targeted polypeptide, protein expression and purification, to quality control, and validation. This paper will report and describe the implementation details and outcomes of the first sessions of the program.
Abstract: In this article our research focused on study of basic physical and mechanical parameters of polymer-cement repair materials is presented. Namely the influence of applied aggregates in combination with active admixture is specially considered. New formulas which were exposed in ambient with temperature even to 1000°C were suggested. Subsequently densities and strength characteristics including their changes were evaluated. Selected samples were analyzed using electron microscope. The positive influence of porous aggregates based on sintered ash was definitely demonstrated. Further it was found than in terms of thermal resistance the effective micro silica amount represents 5% to 7.5% of cement weight.
Abstract: Local utilities often face problems of local industrial
wastes, storm water disposal due to existing strict regulations. For
many local industries, the problem of wastewater treatment and
discharge into surface reservoirs can’t be solved through the use of
conventional biological treatment techniques. Current discharge
standards require very strict removal of a number of impurities such
as ammonia, nitrates, phosphate, etc. To reach this level of removal,
expensive reagents and sorbents are used.
The modern concept of rational water resources management
requires the development of new efficient techniques that provide
wastewater treatment and reuse.
As RO membranes simultaneously reject all dissolved impurities
such as BOD, TDS, ammonia, phosphates etc., they become very
attractive for the direct treatment of wastewater without biological
stage. To treat wastewater, specially designed membrane "open
channel" modules are used that do not possess "dead areas" that cause
fouling or require pretreatment. A solution to RO concentrate
disposal problem is presented that consists of reducing of initial
wastewater volume by 100 times. Concentrate is withdrawn from
membrane unit as sludge moisture. The efficient use of membrane
RO techniques is connected with a salt balance in water system.
Thus, to provide high ecological efficiency of developed techniques,
all components of water supply and wastewater discharge systems
should be accounted for.
Abstract: The optimization of biological systems, which is a branch of metabolic engineering, has generated a lot of industrial and academic interest for a long time. In the last decade, metabolic engineering approaches based on mathematical optimizations have been used extensively for the analysis and manipulation of metabolic networks. In practical optimization of metabolic reaction networks, designers have to manage the nature of uncertainty resulting from qualitative characters of metabolic reactions, e.g., the possibility of enzyme effects. A deterministic approach does not give an adequate representation for metabolic reaction networks with uncertain characters. Fuzzy optimization formulations can be applied to cope with this problem. A fuzzy multi-objective optimization problem can be introduced for finding the optimal engineering interventions on metabolic network systems considering the resilience phenomenon and cell viability constraints. The accuracy of optimization results depends heavily on the development of essential kinetic models of metabolic networks. Kinetic models can quantitatively capture the experimentally observed regulation data of metabolic systems and are often used to find the optimal manipulation of external inputs. To address the issues of optimizing the regulatory structure of metabolic networks, it is necessary to consider qualitative effects, e.g., the resilience phenomena and cell viability constraints. Combining the qualitative and quantitative descriptions for metabolic networks makes it possible to design a viable strain and accurately predict the maximum possible flux rates of desired products. Considering the resilience phenomena in metabolic networks can improve the predictions of gene intervention and maximum synthesis rates in metabolic engineering. Two case studies will present in the conference to illustrate the phenomena.
Abstract: The reported study focuses on pre-service teachers’ professional development during the teaching practice. The cohort studied comprised participants in their final year in the Bachelor of Arts and Bachelor of Science with Graduate Certificate in Education programmes of a university in Fiji. Analysis of the data obtained using a survey questionnaire indicates that overall, the pre-service teachers were satisfied with the practicum experience. This is assumed to demonstrate that the practicum experience contributed well towards their professional preparation for work expected of them in Fiji secondary schools. Participants also identified some concerns as needing attention. To conclude, the paper provides suggestions for improving the preparation of teachers by strengthening the identified areas of the practicum offered by the university. The study has implications for other teacher education providers in small developing island states and even beyond for the purpose of enhancing learning in student teachers’ for future work.
Abstract: This paper aims to study the role and activities of the participants and the impact of activities created in the local area in order to sustainably develop the local areas. This study applied both qualitative and quantitative approaches presented in descriptive style; the data was collected via survey, observation and in-depth interviews with samples. The results illustrated five sorts of roles of participants of the Cicada Walking-street and four types of creative activities; recreation based, art based, cultural based, and live events. Integration of local characteristics, arts and cultures were presented creatively and interestingly. Participants are various. The roles of the participants found in the Cicada Market are group of the property and area management, entrepreneurs, leisure (entertaining persons), local people, and tourists. The good impacts on local communities are those in terms of economy, environmental friendly and local arts and cultures promoting. On the other hand, the traffic congestion, waste and the increasing of energy consumption are negative impacts from area development.