Abstract: Tool, Die and Mould-making (TDM) firms have been
known to play a pivotal role in the growth and development of the
manufacturing sectors in most economies. Their output contributes
significantly to the quality, cost and delivery speed of final
manufactured parts. Unfortunately, the South African Tool, Die and
Mould-making manufacturers have not been competing on the local
or global market in a significant way. This reality has hampered the
productivity and growth of the sector thus attracting intervention. The
paper explores the shortcomings South African toolmakers have to
overcome to restore their competitive position globally. Results from
a global benchmarking survey on the tooling sector are used to
establish a roadmap of what South African toolmakers can do to
become a productive, World Class force on the global market.
Abstract: More than 3000 plants of notable phyto-therapeutic
value grow in South Africa; these include Cissampelos capensis,
commonly known in Afrikaans as dawidjie or dawidjiewortel. C.
capensis is the most significant and popular medicinal plant used by
the Khoisan as well as other rural groups in the Western region of
South Africa. Its rhizomes are traditionally used to treat male fertility
problems. Yet, no studies have investigated the effects of this plant or
its extracts on human spermatozoa. Therefore, this study aimed at
investigating the effects of C. capensis rhizome extract (CRE)
fractions on ejaculated human spermatozoa in vitro. Spermatozoa
from a total of 77 semen samples were washed with human tubular
fluid medium supplemented with bovine serum albumin (HTF-BSA)
and incubated for 2 hours with 20 μg/ml progesterone (P4) followed
by incubation with different concentrations (0, 0.05, 0.5, 5, 50, 200
μg/ml) of fractionated CRE (F1=0% MeOH, F2=30% MeOH,
F3=60% MeOH and F4=100% MeOH) for 1.5 hours at 37°C. A
sample without addition of CRE fractions served as control. Samples
were analyzed for sperm motility, reactive oxygen species (ROS),
DNA-fragmentation, acrosome reaction and capacitation. Results
showed that F1 resulted in significantly higher values for ROS,
capacitation and hyper-activation compared to F2, F3, and F4 with
P4-stimulated samples generally having higher values. No significant
effect was found for the other parameters. In conclusion, alkaloids
present in F1 of CRE appear to have triggered sperm intrinsic ROS
production leading to sperm capacitation and acrosome reaction
induced by P4.
Abstract: This study investigates the use of a time-series of
MODIS NDVI data to identify agricultural land cover change on an
annual time step (2007 - 2012) and characterize the trend. Following
an ISODATA classification of the MODIS imagery to selectively
mask areas not agriculture or semi-natural, NDVI signatures were
created to identify areas cereals and vineyards with the aid of
ancillary, pictometry and field sample data for 2010. The NDVI
signature curve and training samples were used to create a decision
tree model in WEKA 3.6.9 using decision tree classifier (J48)
algorithm; Model 1 including ISODATA classification and Model 2
not. These two models were then used to classify all data for the
study area for 2010, producing land cover maps with classification
accuracies of 77% and 80% for Model 1 and 2 respectively. Model 2
was subsequently used to create land cover classification and change
detection maps for all other years. Subtle changes and areas of
consistency (unchanged) were observed in the agricultural classes
and crop practices. Over the years as predicted by the land cover
classification. Forty one percent of the catchment comprised of
cereals with 35% possibly following a crop rotation system.
Vineyards largely remained constant with only one percent
conversion to vineyard from other land cover classes.
Abstract: International and domestic environmental law has
evolved quite rapidly in the last few decades. At the international
level the Stockholm and Rio Declarations paved the way for a broad
based consensus of the international community on environmental
issues and principles. At the Domestic level also many states have
incorporated environmental protection in their constitutions and even
more states are doing the same at least in their domestic legislations.
In this process of evolution environmental law has unleashed a
number of novel principles such as; the participatory principle, the
polluter pays principle, the precautionary principle, the intergenerational
and intra-generational principles, the prevention
principle, the sustainable development principle and so on.
Abstract: This paper examines the effect of the volatility of oil
prices on food price in South Africa using monthly data covering the
period 2002:01 to 2014:09. Food price is measured by the South
African consumer price index for food while oil price is proxied by
the Brent crude oil. The study employs the GARCH-in-mean VAR
model, which allows the investigation of the effect of a negative and
positive shock in oil price volatility on food price. The model also
allows the oil price uncertainty to be measured as the conditional
standard deviation of a one-step-ahead forecast error of the change in
oil price. The results show that oil price uncertainty has a positive
and significant effect on food price in South Africa. The responses of
food price to a positive and negative oil price shocks is asymmetric.
Abstract: This paper argues nation-building theories that
prioritize democratic governance best explain the successful postindependence
development of Botswana. Three main competing
schools of thought exist regarding the sequencing of policies that
should occur to re-build weakened or failed states. The first posits
that economic development should receive foremost attention, while
democratization and a binding sense of nationalism can wait. A
second group of experts identified constructing a sense of nationalism
among a populace is necessary first, so that the state receives popular
legitimacy and obedience that are prerequisites for development.
Botswana, though, transitioned into a multi-party democracy and
prosperous open economy due to the utilization of traditional
democratic structures, enlightened and accountable leadership, and an
educated technocratic civil service. With these political foundations
already in place when the discovery of diamonds occurred, the
resulting revenues were spent wisely on projects that grew the
economy, improved basic living standards, and attracted foreign
investment. Thus democratization preceded, and therefore provided
an accountable basis for, economic development that might otherwise
have been squandered by greedy and isolated elites to the detriment
of the greater population. Botswana was one of the poorest nations in
the world at the time of its independence in 1966, with little
infrastructure, a dependence on apartheid South Africa for trade, and
a largely subsistence economy. Over the next thirty years, though, its
economy grew the fastest of any nation in the world. The transparent
and judicious use of diamond returns is only a partial explanation, as
the government also pursued economic diversification, mass
education, and rural development in response to public needs.
As nation-building has become a project undertaken by nations
and multilateral agencies such as the United Nations and the North
Atlantic Treaty Organization, Botswana may provide best practices
that others should follow in attempting to reconstruct economically
and politically unstable states.
Abstract: Innovation plays an important role in economic
growth and development. Evolutionary economics has entrepreneurs
at the centre of the innovation system, but includes all other
participants as contributors to the performance of the innovation
system. Education and training institutions, one of the participants in
the innovation system, contributes in different ways to human capital.
The gap in literature on the competence building as part of human
capital in the analysis of innovation systems is addressed in this
paper. The Mpumalanga Province of South Africa is used as a case
study. It was found that the absence of a university, the level of
education, the quality and performance in the education sector and
the condition of the education infrastructure have not been conducive
to learning.
Abstract: This article discusses issues related to the System of
Innovation: Comparing economies of Brazil and South Africa.
Having as this study aimed at comparing the Innovation System of
the countries mentioned. Then briefly describe the process of Venture
Capital and present the industry innovation in Brazil and South
Africa. The methodological approach described in this article is
descriptive and the approach is qualitative, taking as a basis
secondary data relating to research articles. The main results are
related to the different forms of financing of Venture Capital used by
countries compared, in addition to the training and economic policy.
And finally, it was highlighted the importance of implementation of
policy reforms for the Brazil and Africa in the innovation process.
Abstract: Numeracy, like Literacy is considered to be a core
value of modern societies. Most higher education institutions in
South Africa include being numerate as an important graduate
attribute. It is argued that a suitability numerate society contributes to
social justice, empowerment, financial and environmental
sustainability and a lack of numeracy practices can contribute to
disempowerment.
Numeracy is commonly misconstrued as a basic and simple
practice, similar in nature to basic arithmetic. This study highlights
the complexities of higher education numeracy practices by analyzing
a programme in a higher education institution in South Africa using
the New Literacies Studies perspective.
Abstract: This research study is an exploration of the selfdirected
professional development of teachers who teach in public
schools in an era of democracy and educational change in South
Africa. Amidst an ever-changing educational system, the teachers in
this study position themselves as self-directed teacher-learners where
they adopt particular learning practices which enable change within
the broader discourses of public schooling. Life-story interviews
were used to enter into the private and public spaces of five teachers
which offer glimpses of how particular systems shaped their
identities, and how the meanings of self-directed teacher-learner
shaped their learning practices. Through the Multidimensional
Framework of Analysis and Interpretation the teachers’ stories were
analysed through three lenses: restorying the field texts - the self
through story; the teacher-learner in relation to social contexts, and
practices of self-directed learning. This study shows that as teacherlearners
learn for change through self-directed learning practices,
they develop their agency as transformative intellectuals, which is
necessary for the reworking of South African public schools.
Abstract: Science and technology has a major impact on many
societal domains such as communication, medicine, food,
transportation, etc. However, this dominance of modern technology
can have a negative unintended impact on indigenous systems, and in
particular on indigenous foods. This problem serves as a motivation
to this study whose aim is to examine the perceptions of learners on
the usefulness of Information and Communication Technologies
(ICTs) for learning about indigenous foods. This aim will be
subdivided into two types of research objectives. The design and
identification of theories and models will be achieved using literature
content analysis. The objective on the empirical testing of such
theories and models will be achieved through the survey of
Hospitality studies learners from different schools in the iLembe and
Umgungundlovu Districts of the South African Kwazulu-Natal
province. SPSS is used to quantitatively analyze the data collected by
the questionnaire of this survey using descriptive statistics and
Pearson correlations after the assessment of the validity and the
reliability of the data. The main hypothesis behind this study is that
there is a connection between the demographics of learners, their
perceptions on the usefulness of ICTs for learning about indigenous
foods, and the following personality and eLearning related theories
constructs: Computer self-efficacy, Trust in ICT systems, and
Conscientiousness; as suggested by existing studies on learning
theories. This hypothesis was fully confirmed by the survey
conducted by this study except for the demographic factors where
gender and age were not found to be determinant factors of learners’
perceptions on the usefulness of ICTs for learning about indigenous
foods.
Abstract: South Africa has some regions which are susceptible
to moderate seismic activity. A peak ground acceleration of between
0.1g and 0.15g can be expected in the southern parts of the Western
Cape. Unreinforced Masonry (URM) is commonly used as a
construction material for 2 to 5 storey buildings in underprivileged
areas in and around Cape Town. URM is typically regarded as the
material most vulnerable to damage when subjected to earthquake
excitation. In this study, a three-storey URM building was analysed
by applying seven earthquake time-histories, which can be expected
to occur in South Africa using a finite element approach.
Experimental data was used to calibrate the in- and out-of-plane
stiffness of the URM. The results indicated that tensile cracking of
the in-plane piers was the dominant failure mode. It is concluded that
URM buildings of this type are at risk of failure especially if
sufficient ductility is not provided. The results also showed that
connection failure must be investigated further.
Abstract: The use of information and communication
technologies such as computers, mobile phones and the Internet is
becoming prevalent in today’s world; and it is facilitating access to a
vast amount of data, services and applications for the improvement of
people’s lives. However, this prevalence of ICTs is hampered by the
problem of low income levels in developing countries to the point
where people cannot timeously replace or repair their ICT devices
when damaged or lost; and this problem serves as a motivation for
this study whose aim is to examine the perceptions of teachers on the
reliability of cellphones when used for teaching and learning
purposes. The research objectives unfolding this aim are of two
types: Objectives on the selection and design of theories and models,
and objectives on the empirical testing of these theories and models.
The first type of objectives is achieved using content analysis in an
extensive literature survey: and the second type of objectives is
achieved through a survey of high school teachers from the ILembe
and UMgungundlovu districts in the KwaZulu-Natal province of
South Africa. Data collected from this questionnaire based survey is
analysed in SPSS using descriptive statistics and Pearson correlations
after checking the reliability and validity of the questionnaires. The
main hypothesis driving this study is that there is a relationship
between the demographics and the attribution identity of teachers on
one hand, and their perceptions on the reliability of cellphones on the
other hand, as suggested by existing literature; except that attribution
identities are considered in this study under three angles: intention,
knowledge and ability, and action. The results of this study confirm
that the perceptions of teachers on the reliability of cellphones for
teaching and learning are affected by the school location of these
teachers, and by their perceptions on learners’ cellphones usage
intentions and actual use.
Abstract: The postharvest quality management of tomatoes is
important to limit the amount of losses that occur due to deterioration
between harvest and consumption. This study was undertaken to
investigate the effects of pre- and postharvest integrated agrotechnologies,
involving greenhouse microclimate and postharvest
storage conditions, on the postharvest quality attributes of four
tomato cultivars. Tomato fruit firmness, colour (hue angle (h°) and
L* value), pH and total soluble solids for the cultivars Bona,
Star 9037, Star 9009 and Zeal, grown in a fan-pad evaporativelycooled
and an open-ended naturally-ventilated tunnel, were harvested
at the mature-green stage. The tomatoes were stored for 28 days
under cold storage conditions, with a temperature of 13°C and RH of
85%, and under ambient air conditions, with a temperature of 23±
2°C and RH of 52± 4%. This study has provided information on the
effect of integrated pre-harvest and postharvest agro-technologies,
involving greenhouse microclimate and postharvest storage
environment on the postharvest quality attributes of four of the
tomato cultivars in South Africa. NVT-grown tomatoes retained
better textural qualities, but ripened faster by changing from green to
red faster, although these were reduced under cold storage conditions.
FPVT-grown tomatoes had lower firmness, but ripened slowly with
higher colour attributes. With cold storage conditions, the firmness of
FPVT-grown tomatoes was maintained. Cultivar Bona firmness and
colour qualities depreciated the fastest, but it had higher TSS content
and lower pH values. Star 9009 and Star 9037 presented better
quality, by retaining higher firmness and ripening slowly, but they
had the lowest TSS contents and high pH values, especially
Star 9037. Cold storage improved the firmness of tomato cultivars
with poor textural quality and faster colour changes.
Abstract: Nations are still finding it quite difficult to win mega
sport competitions despite the major contribution of sport to society
in terms of social and economic development, personal health, and in
education. Even though the world of sports has been transformed into
a huge global economy, it is important to note that the first step of
sport is usually its introduction to children at school through physical
education or PE. In other words, nations who do not win mega sport
competitions also suffer from a weak and neglected PE system. This
problem of the neglect of PE systems is the main motivation of this
research aimed at examining the factors affecting the perceived
awareness of physical education teachers on the ICTs that are
adoptable for the teaching and learning of physical education. Two
types of research objectives will materialize this aim: relevant
theories will be identified in relation to the analysis of the perceived
ICT awareness of PE teachers and subsequent models will be
compiled and designed from existing literature; the empirical testing
of such theories and models will also be achieved through the survey
of PE teachers from the Camperdown magisterial district of the
KwaZulu-Natal province of South Africa. The main hypothesis at the
heart of this study is the relationship between the demographics of PE
teachers, their behavior both as individuals and as social entities, and
their perceived awareness of the ICTs that are adoptable for PE, as
postulated by existing literature; except that this study categorizes
human behavior under performance expectancy, computer attitude,
and social influence. This hypothesis was partially confirmed by the
survey conducted by this research in the sense that performance
expectancy and teachers’ age, gender, computer usage, and class size
were found to be the only factors affecting their awareness of ICTs
for physical education.
Abstract: Age ratings are very helpful in providing parents with
relevant information for the purchase and use of digital technologies
by the children; this is why the non-definition of age ratings for the
use of ICTs by children in schools is a major concern; and this
problem serves as a motivation for this study whose aim is to
examine the factors affecting the perceptions of educators on the
learners’ youngest age for the introduction of ICTs in schools. This
aim is achieved through two types of research objectives: the
identification and design of theories and models on age ratings, and
the empirical testing of such theories and models in a survey of
educators from the Camperdown district of the South African
KwaZulu-Natal province. A questionnaire is used for the collection
of the data of this survey whose validity and reliability is checked in
SPSS prior to its descriptive and correlative quantitative analysis. The
main hypothesis supporting this research is the association between
the demographics of educators, their personality, and their
perceptions on the learners’ youngest age for the introduction of ICTs
in schools; as claimed by existing research; except that the present
study looks at personality from three dimensions: self-actualized
personalities, fully functioning personalities, and healthy
personalities. This hypothesis was fully confirmed by the empirical
study conducted by this research except for the demographic factor
where only the educators’ grade or class was found to be associated
with the personality of educators.
Abstract: Information and Communication Technologies (ICTs)
are pervasive nowadays, including in education where they are
expected to improve the performance of learners. However, the hope
placed in ICTs to find viable solutions to the problem of poor
academic performance in schools in the developing world has not yet
yielded the expected benefits. This problem serves as a motivation to
this study whose aim is to examine the perceptions of educators on
the advantages and disadvantages of e-learning. This aim will be
subdivided into two types of research objectives. Objectives on the
identification and design of theories and models will be achieved
using content analysis and literature review. However, the objective
on the empirical testing of such theories and models will be achieved
through the survey of educators from different schools in the
Pinetown District of the South African Kwazulu-Natal province.
SPSS is used to quantitatively analyse the data collected by the
questionnaire of this survey using descriptive statistics and Pearson
correlations after assessing the validity and the reliability of the data.
The main hypothesis driving this study is that there is a relationship
between the demographics of educators’ and their adherence to
learning theories on one side, and their perceptions on the advantages
and disadvantages of e-learning on the other side, as argued by
existing research; but this research views these learning theories
under three perspectives: educators’ adherence to self-regulated
learning, to constructivism, and to progressivism. This hypothesis
was fully confirmed by the empirical study except for the
demographic factor where teachers’ level of education was found to
be the only demographic factor affecting the perceptions of educators
on the advantages and disadvantages of e-learning.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This paper seeks to illustrate the impact of rapid urbanization (in terms of both increase in people and vehicles) in the Gauteng region (which includes Johannesburg, Pretoria and Ekurhuleni). The impact that existing transport systems and options place on the capacity of residents from low income areas to travel and conduct various socio-economic activities is discussed. The findings are drawn from a 2013 analysis of a random transport household survey of 1550 households carried out in Gauteng province. 91.4% of the study respondents had access to public transport, while 8.6% had no access to public transport. Of the 91.4% who used public transport, the main reason used to explain this state of affairs was that it was affordable (54.3%), convenient (15.9%), Accessible (11.9%), lack of alternatives (6.4%) and reliable at 4.1%. Recommendations advanced revolve around the need to reverse land use and transportation effects of apartheid planning, growing and developing a sustainable critical mass of public transport interventions supported by appropriate transport systems that are environmentally sustainable through proper governance. 38.5% of the respondents indicated that developing compact, smart and integrated urban land spaces was key to reducing travel challenges in the study area. 23.4% indicated that the introduction and upgrading of BRT buses to cover all areas in the study area was a step in the right direction because it has great potential in shifting travel patterns to favor public modes of transport. 15.1% indicated that all open spaces should be developed so that fragmentation of land uses can be addressed. This would help to fight disconnected and fragmented space and trip making challenges in Gauteng. 13.4% indicated that improving the metro rail services was critical since this is a mass mover of commuters. 9.6% of the respondents highlighted that the bus subsidy policy has to be retained in the short to medium term since the spatial mismatches and challenges created by apartheid are yet to be fully reversed.
Abstract: In today’s world, internal fraud remains one of the most challenging problems within companies worldwide and despite investment in controls and attention given to the problem, the instances of internal fraud has not abated. To the contrary it appears that internal fraud is on the rise especially in the wake of the economic downturn.
Leadership within companies believes that the more sophisticated the controls employed the less likely it would be for employees to pilfer. This is a very antiquated view as investment in controls may not be enough to curtail internal fraud; however, ensuring that a company drives the correct culture and behavior within the organization is likely to yield desired results.
This research aims to understand how creating a strong ethical culture and embedding the principle of good corporate governance impacts on levels of internal fraud with an organization (a South African Bank).