Abstract: Age ratings are very helpful in providing parents with
relevant information for the purchase and use of digital technologies
by the children; this is why the non-definition of age ratings for the
use of ICTs by children in schools is a major concern; and this
problem serves as a motivation for this study whose aim is to
examine the factors affecting the perceptions of educators on the
learners’ youngest age for the introduction of ICTs in schools. This
aim is achieved through two types of research objectives: the
identification and design of theories and models on age ratings, and
the empirical testing of such theories and models in a survey of
educators from the Camperdown district of the South African
KwaZulu-Natal province. A questionnaire is used for the collection
of the data of this survey whose validity and reliability is checked in
SPSS prior to its descriptive and correlative quantitative analysis. The
main hypothesis supporting this research is the association between
the demographics of educators, their personality, and their
perceptions on the learners’ youngest age for the introduction of ICTs
in schools; as claimed by existing research; except that the present
study looks at personality from three dimensions: self-actualized
personalities, fully functioning personalities, and healthy
personalities. This hypothesis was fully confirmed by the empirical
study conducted by this research except for the demographic factor
where only the educators’ grade or class was found to be associated
with the personality of educators.
Abstract: Urban greenery remains the bastion of urban
landscape and a key to sustainable development due to its integral
connections to the general health and wellbeing of urban residents.
However, in an era of rapid urbanisation, recent studies indicate that
urban greenery, especially ecologically sensitive areas, in many
African cities is becoming increasingly depleted. Given the scale and
rate of natural and anthropogenic change, effective management of
urban greenery as the ultimate goal of restoring depleting urban
landscapes is urgent. This review advocates for an urban resilience
model to managing urban greenery.
Abstract: Information and Communication Technologies (ICTs)
are pervasive nowadays, including in education where they are
expected to improve the performance of learners. However, the hope
placed in ICTs to find viable solutions to the problem of poor
academic performance in schools in the developing world has not yet
yielded the expected benefits. This problem serves as a motivation to
this study whose aim is to examine the perceptions of educators on
the advantages and disadvantages of e-learning. This aim will be
subdivided into two types of research objectives. Objectives on the
identification and design of theories and models will be achieved
using content analysis and literature review. However, the objective
on the empirical testing of such theories and models will be achieved
through the survey of educators from different schools in the
Pinetown District of the South African Kwazulu-Natal province.
SPSS is used to quantitatively analyse the data collected by the
questionnaire of this survey using descriptive statistics and Pearson
correlations after assessing the validity and the reliability of the data.
The main hypothesis driving this study is that there is a relationship
between the demographics of educators’ and their adherence to
learning theories on one side, and their perceptions on the advantages
and disadvantages of e-learning on the other side, as argued by
existing research; but this research views these learning theories
under three perspectives: educators’ adherence to self-regulated
learning, to constructivism, and to progressivism. This hypothesis
was fully confirmed by the empirical study except for the
demographic factor where teachers’ level of education was found to
be the only demographic factor affecting the perceptions of educators
on the advantages and disadvantages of e-learning.
Abstract: High resolution seismic reflection has recently been carried out on Zaria batholith, with the aim of characterizing the granitic Zaria batholiths in terms of its lithology. The geology of the area has revealed that the older granite outcrops in the vicinity of Zaria are exposures of a syntectonics to late-tectonic granite batholiths which intruded a crystalline gneissic basement during the Pan-African Orogeny. During the data acquisition the geophone were placed at interval of 1 m, variable offset of 1 and 10 m was used. The common midpoint (CMP) method with 12 fold coverage was employed for the survey. Analysis of the generated 3D surface of the p wave velocities from different profiles for densities and bulk modulus revealed that the rock material is more consolidated in South East part of the batholith and less consolidated in the North Western part. This was in conformity with earlier identified geology of the area, with the South Eastern part majorly of granitic outcrop, while the North Western part is characterized with the exposure of gneisses and thick overburden cover. The difference in lithology was also confirmed by the difference in seismic sections and Arial satellite photograph. Hence two major lithologies were identified, the granitic and gneisses complex which are characterized by gradational boundaries.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Regular exercise promotes reduction in blood pressure, reduction in body weight and it also helps to increase in insulin sensitivity. Participation in physical activity should always be linked to medical screening which can reveal serious medical problems. One of them is high blood pressure. Hypertension is risk factor for one billion people worldwide and the highest prevalence is found in Africa. Another component of hypertension is that people who suffer from hypertension have no symptoms. It is estimated that reduction of 3mm Hg in Systolic Blood Pressure decreases cardiac morbidity at least 5%. The most of the guidelines suggest aerobic exercise in a prevention of cardiovascular diseases. On the other hand, it is important to emphasize the impact of resistance training. Even, it was found higher effect for reduction on the level of systolic blood pressure than aerobic exercise.
Abstract: Although urbanization in Africa has been characterized by fragile socio-economic successes, the sustainability of city infrastructure is now central to planning processes as a pathway to closing the deficit in terms of coverage and access. This paper builds on survey and interview data from Kampala city, to demonstrate how the principle gender responsiveness can inform improvements in urban infrastructure and service delivery. We discovered that women prefer infrastructure that combines living and working spaces for reduced labour and travel burdens between homes, markets, schools, and other urban spaces. Men’s conception of infrastructure needs on the other hand, mirrored public security and connectivity concerns along city streets and work places. However, the urban planning approach at city-level is guided by mainstream engineering and architectural designs that do not necessarily reflect the social context within which urban infrastructure influences gender roles and the attendant mobility needs. To address the challenge across cities of similar context, the paper concludes with a set of analytic steps on how the gendered influences on infrastructure-use can be considered in urban planning cycles.
Abstract: This paper seeks to illustrate the impact of rapid urbanization (in terms of both increase in people and vehicles) in the Gauteng region (which includes Johannesburg, Pretoria and Ekurhuleni). The impact that existing transport systems and options place on the capacity of residents from low income areas to travel and conduct various socio-economic activities is discussed. The findings are drawn from a 2013 analysis of a random transport household survey of 1550 households carried out in Gauteng province. 91.4% of the study respondents had access to public transport, while 8.6% had no access to public transport. Of the 91.4% who used public transport, the main reason used to explain this state of affairs was that it was affordable (54.3%), convenient (15.9%), Accessible (11.9%), lack of alternatives (6.4%) and reliable at 4.1%. Recommendations advanced revolve around the need to reverse land use and transportation effects of apartheid planning, growing and developing a sustainable critical mass of public transport interventions supported by appropriate transport systems that are environmentally sustainable through proper governance. 38.5% of the respondents indicated that developing compact, smart and integrated urban land spaces was key to reducing travel challenges in the study area. 23.4% indicated that the introduction and upgrading of BRT buses to cover all areas in the study area was a step in the right direction because it has great potential in shifting travel patterns to favor public modes of transport. 15.1% indicated that all open spaces should be developed so that fragmentation of land uses can be addressed. This would help to fight disconnected and fragmented space and trip making challenges in Gauteng. 13.4% indicated that improving the metro rail services was critical since this is a mass mover of commuters. 9.6% of the respondents highlighted that the bus subsidy policy has to be retained in the short to medium term since the spatial mismatches and challenges created by apartheid are yet to be fully reversed.
Abstract: The primary purpose of this study is to understand the differences in the relationship between working capital management efficiency, working capital investment decisions and working capital finance decisions and the profitability of firms within the context of two African developing economies, Kenya and Nigeria. The study finds that there is a significant difference in the relationship between the firm’s profitability and the working capital variables which suggests different challenges for working capital management in each of these countries.
Abstract: In today’s world, internal fraud remains one of the most challenging problems within companies worldwide and despite investment in controls and attention given to the problem, the instances of internal fraud has not abated. To the contrary it appears that internal fraud is on the rise especially in the wake of the economic downturn.
Leadership within companies believes that the more sophisticated the controls employed the less likely it would be for employees to pilfer. This is a very antiquated view as investment in controls may not be enough to curtail internal fraud; however, ensuring that a company drives the correct culture and behavior within the organization is likely to yield desired results.
This research aims to understand how creating a strong ethical culture and embedding the principle of good corporate governance impacts on levels of internal fraud with an organization (a South African Bank).
Abstract: A cross-sectional survey to ascertain the capacity of laboratory persons in using ICTs was conducted in 15 Ugandan districts (July-August 2013). A self-administered questionnaire served as data collection tool, interview guide and observation checklist. 69 questionnaires were filled, 12 interviews conducted, 45 HC observed. SPSS statistics 17.0 and SAS 9.2 software were used for entry and analyses. 69.35% of participants find it difficult to access a computer at work. Of the 30.65% who find it easy to access a computer at work, a significant 21.05% spend 0 hours on a computer daily. 60% of the participants cannot access internet at work. Of the 40% who have internet at work, a significant 20% lack email address but 20% weekly read emails weekly and 48% daily. It is viable/feasible to pilot informatics projects as strategies to build bridges develop skills for e-health landscape in laboratory services with a bigger financial muscle.
Abstract: The present study aimed to investigate the effect of two type of soil (clay and sandy soils) in the potential allelopathic effects of Artemisia herba-alba, Oudneya africana crude powder (0, 1, 3 and 6%) on some growth parameters of two weeds (Bromus tectorum and Melilotus indica) under laboratory conditions (pot experiment).
The experimental findings have reported that the donor species crude powder concentrations were suppressing to shoot length (SL), root length (RL) and the leaf number (LN)) in both soil types and caused a gradual reduction particularly when they are high. However, the reduction degree was varied and species, concentration dependent. The suppressive effect of the two donors on the two weedy species was in the following order Melilotus indica > Bromus tectorum. Generally, the growth parameters of two recipient species were significantly decreased with the increase of each of the donor species crude powder concentration levels. Concerning the type of soil stoical analyses indicated that significant difference between clay and sandy soils.
Abstract: In this study, the in vitro anticholinesterase activity of
the volatile oils of both O. basilicum and O. africanum was
investigated and both samples showed significant activity. The major
constituents of the two oils were isolated using several column
chromatographies. Linalool, 1,8-cineol and eugenol were isolated
from the volatile oil of O. basilicum and camphor was isolated from
the volatile oil of O. africanum. The anticholinesterase activities of
the isolated compounds were also evaluated where 1,8-cineol showed
the highest inhibitory activity followed by camphor. To confirm these
activities, learning and memory enhancing effects were tested in
mice. Memory impairment was induced by scopolamine, a
cholinergic muscarinic receptor antagonist. Anti-amnesic effects of
both volatile oils and their terpenoids were investigated by the
passive avoidance task in mice. We also examined their effects on
brain acetylcholinesterase activity. Results showed that scopolamineinduced
cognitive dysfunction was significantly attenuated by
administration of the volatile oils and their terpenoids, eugenol and
camphor, in the passive avoidance task and inhibited brain
acetylcholinesterase activity. These results suggest that O. basilicum
and O. africanum volatile oils can be good candidates for further
studies on Alzheimer’s disease via their acetylcholinesterase
inhibitory actions.
Abstract: Across the world, initiatives have been introduced to encourage women to enter into and remain in engineering fields. However, research has shown that many women leave engineering or suffer a loss of self-esteem and self-confidence compared to their male counterparts. To address this problem, a South African comprehensive university developed a self-leadership intervention pilot study in 2013, aimed at improving the self-efficacy of its female engineering students and increasing retention rates. This paper is a qualitative, descriptive, and interpretive study of the rationale and operational aspects of the Women in Engineering Leadership Association’s (WELA) self-leadership workshop. The objectives of this paper are to provide a framework for the design of a self-leadership workshop and to provide insight into the process of developing such a workshop specifically for women engineering students at a South African university. Finally, the paper proposes an evaluation process for the pilot workshop, which also provides a framework to improve future workshops. It is anticipated that the self-leadership development framework will be applicable to other higher education institutions wishing to improve women engineering student’s feelings of self-efficacy and therefore retention rates of women in engineering.
Abstract: Vacant City of Cape Town-owned land lying unutilized and -productive could be developed for land uses such as urban agriculture that may improve the livelihoods of low income families. The new City of Cape Town zoning scheme includes an Urban Agriculture zoning for the first time. Unstructured qualitative interviews among town planners revealed their optimism about this inclusion as it will provide low-income residents with opportunities to generate an income. An existing farming community at Philippi, located within the municipal boundary of the city, was approached and empirical data obtained through questionnaires provided proof that urban agriculture could be viable in a coastal metropolitan city such as Cape Town even if farmers only produce for their own households. The lease method proposed for urban agriculture is a usufruct agreement conferring the right to another party, other than the legal owner, to enjoy the use and advantages of the property.
Abstract: This article investigates technology used by Tshwane residents intended for tourism purposes. The aim is to contribute information for planning and management concerning technology within the tourism sector in the city of Tshwane, South Africa. This study identified the types of tourist related technologies used by the Tshwane residents, be it for business purposes or personal use. The study connected the exploitation of technology for tourism purposes through unpacking the tourism sector as it utilizes technology. Quantitative research methodology was used whereby self-completed questionnaires were chosen as research instruments. The research study carried out a search for knowledge on technology for tourism and the Tshwane residents; however the study revealed that technology has certainly imprinted tourism massively because of its effectiveness and efficiency. Technology has assisted tourism businesses stay abreast of competition with integrated communication technology (ICT) and because of that, SA is on the map as one of the economically performing countries in Africa. Moreover, technology and tourism make a meaningful impact on job creation and Gross Domestic Product (GDP).
Abstract: Honey bees are the most important insects because of their ecologic and economic impacts. They pollinate more than 200 flowering crop plants resulting in an increased yield. Also, honey bees provide multiple products such as honey, royal jelly, wax, venom, pollen and propolis. Beekeeping has been practiced by Africans in all parts of the continent for many thousands of years. However, there is a little scientific information published worldwide about beekeeping in Libya. This review article aims to shed light on the history and current status of honey bee keeping in Libya.
Abstract: Gastrointestinal parasitic infections are common health problems in sub-Saharan Africa. A cross- sectional study was carried out to determine the prevalence of gastrointestinal parasites among workers in major abattoirs in Port Harcourt, Nigeria. These abattoirs are located in Trans-Amadi, Rumuodumaya, Mile III and Easter-by-Pass. Formol-ether concentration technique was used to isolate the ova and cysts from faecal samples. Out of 201 workers (herdsmen, butchers, and cleaners) investigated for the presence of these parasites, 89 (44.2%) were infected with one or more parasites. The prevalence of the parasites among herdsmen and cleaners was significantly (P0.05) difference in the prevalence of gastrointestinal parasites in relation to age. Parasites identified included Ascaris lumbricoide (33.3%), tapeworm (4.97%), Entamoeba histolytica (5.47%), hookworms (13.9%), Trichuris trichiura (9.95%), Gardia lamblia (3.48%), and Schistosoma mansoni (1.9%). The frequency of A. lumbricoide was significantly (P
Abstract: Although many factors play a significant role in agricultural production and productivity, the importance of soil fertility cannot be underestimated. The extent to which small farmers are able to manage the fertility of their farmlands is crucial in agricultural development particularly in sub-Saharan Africa (SSA). This paper assesses the nutrient status of selected farmers’ fields in relation to how government policy addresses the allocation of and access to agricultural inputs (e.g. chemical fertilizers) in a unique social-ecological environment of the Okavango Delta in northern Botswana. It also analyses small farmers and soil scientists’ perceptions about the political economy of integrated soil fertility management (ISFM) in the area. A multi-stage sampling procedure was used to elicit quantitative and qualitative information from 228 farmers and 9 soil researchers through the use of interview schedules and questionnaires, respectively. Knowledge validation workshops and focus group discussions (FGDs) were also used to collect qualitative data from farmers. Thirty-three composite soil samples were collected from 30 farmers’ plots in three farming communities of Makalamabedi, Nokaneng and Mohembo for laboratory analysis. While meeting points exist, farmers and scientists have divergent perspectives on soil fertility management. Laboratory analysis carried out shows that most soils in the wetland and the adjoining dry-land/upland surroundings are low in essential nutrients as well as in cation exchange capacity (CEC). Although results suggest the identification and use of appropriate inorganic fertilizers, the low CEC is an indication that holistic cultural practices, which are beyond mere chemical fertilizations, are critical and more desirable for improved soil health and sustainable livelihoods in the area. Farmers’ age (t= -0.728; p≤0.10); their perceptions about the political economy (t = -0.485; p≤0.01) of ISFM; and their preference for the use of local knowledge in soil fertility management (t = -10.254; p≤0.01) had a significant relationship with how they perceived their involvement in the implementation of ISFM.
Abstract: The Romain paths or roads offer a very interesting archaeological material, because they allow us to understand the history of human settlement and are also factors that increase territorial identity. Roman roads are one of the hallmarks of the Roman empire, which extends to North Africa. The objective of this investigation is to attract the attention of researchers of the importance of Roman roads and paths, which are found in Algeria, according to the quality of the materials and techniques used in this period our history, and to encourage other decision makers to protect and enhance these routes because the current urbanization, intensive agricultural practices, or simply forgotten, decreases the sustainability of this important historical heritage.