Abstract: Surplus electricity can be converted into potential energy via pumped hydroelectric storage for future usage. Similarly, thermo-electric energy storage (TEES) uses heat pumps equipped with thermal storage to convert electrical energy into thermal energy; the stored energy is then converted back into electrical energy when necessary using a heat engine. The greatest advantage of this method is that, unlike pumped hydroelectric storage and compressed air energy storage, TEES is not restricted by geographical constraints. In this study, performance variation of the TEES according to the changes in cold-side storage temperature was investigated by simulation method.
Abstract: Prior literature on innovation diffusion or acceptance has almost exclusively concentrated on consumers’ positive attitudes and behaviors for new products/services. Consumers’ negative attitudes or behaviors to innovations have received relatively little marketing attention, but it happens frequently in practice. This study discusses consumer psychological factors when they try to learn or use new technologies. According to recent research, technological innovation acceptance has been considered as a dynamic or mediated process. This research argues that consumers can experience inertia and emotions in the initial use of new technologies. However, given such consumer psychology, the argument can be made as to whether the inclusion of consumer inertia (routine seeking and cognitive rigidity) and emotions increases the predictive power of new technology acceptance model. As data from the empirical study find, the process is potentially consumer emotion changing (independent of performance benefits) because of technology complexity and consumer inertia, and impact innovative technology use significantly. Finally, the study presents the superior predictability of the hypothesized model, which let managers can better predict and influence the successful diffusion of complex technological innovations.
Abstract: Solid lipid nanoparticles (SLNs) have gained great attention for the topical treatment of skin associated fungal infection as they facilitate the skin penetration of loaded drugs. Our work deals with the preparation of nystatin loaded solid lipid nanoparticles (NystSLNs) using the hot homogenization and ultrasonication method. The prepared NystSLNs were characterized in terms of entrapment efficiency, particle size, zeta potential, transmission electron microscopy, differential scanning calorimetry, rheological behavior and in vitro drug release. A stability study for 6 months was performed. A microbiological study was conducted in male rats infected with Candida albicans, by counting the colonies and examining the histopathological changes induced on the skin of infected rats. The results showed that SLNs dispersions are spherical in shape with particle size ranging from 83.26±11.33 to 955.04±1.09 nm. The entrapment efficiencies are ranging from 19.73±1.21 to 72.46±0.66% with zeta potential ranging from -18.9 to -38.8 mV and shear-thinning rheological Behavior. The stability studies done for 6 months showed that nystatin (Nyst) is a good candidate for topical SLN formulations. A least number of colony forming unit/ ml (cfu/ml) was recorded for the selected NystSLN compared to the drug solution and the commercial Nystatin® cream present in the market. It can be fulfilled from this work that SLNs provide a good skin targeting effect and may represent promising carrier for topical delivery of Nyst offering the sustained release and maintaining the localized effect, resulting in an effective treatment of cutaneous fungal infection.
Abstract: Generally, distributed generation units refer to small-scale electric power generators that produce electricity at a site close to the customer or an electric distribution system (in parallel mode). From the customers’ point of view, a potentially lower cost, higher service reliability, high power quality, increased energy efficiency, and energy independence can be the key points of a proper DG unit. Moreover, the use of renewable types of distributed generations such as wind, photovoltaic, geothermal or hydroelectric power can also provide significant environmental benefits. Therefore, it is of crucial importance to study their impacts on the distribution networks. A marked increase in Distributed Generation (DG), associated with medium voltage distribution networks, may be expected. Nowadays, distribution networks are planned for unidirectional power flows that are peculiar to passive systems, and voltage control is carried out exclusively by varying the tap position of the HV/MV transformer. This paper will compare different DG control methods and possible network reconfiguration aimed at assessing their effect on voltage profiles.
Abstract: Many organizations are opting to adopt Open Source Software (OSS) as it is the current trend to rely on each other rather than on companies (Software vendors). It is a clear shift from organizations to individuals, the concept being to rely on collective participation rather than companies/vendors.
The main objectives of this research are 1) to identify the current level of OSS usage in Sultan Qaboos University; 2) to identify the potential benefits of using OSS in educational institutes; 3) to identify the OSS applications that are most likely to be used within an educational institute; 4) to identify the existing and potential barriers to the successful adoption of OSS in education.
To achieve these objectives a two-stage research method was conducted. First a rigorous literature review of previously published material was performed (interpretive/descriptive approach), and then a set of interviews were conducted with the IT professionals at Sultan Qaboos University in Oman in order to explore the extent and nature of their usage of OSS.
Abstract: As an emerging business model, cloud computing has been initiated to satisfy the need of organizations and to push Information Technology as a utility. The shift to the cloud has changed the way Information Technology departments are managed traditionally and has raised many concerns for both, public and private sectors.
The purpose of this study is to investigate the possibility of cloud computing services replacing services provided traditionally by IT departments. Therefore, it aims to 1) explore whether organizations in Oman are ready to move to the cloud; 2) identify the deciding factors leading to the adoption or rejection of cloud computing services in Oman; and 3) provide two case studies, one for a successful Cloud provider and another for a successful adopter.
This paper is based on multiple research methods including conducting a set of interviews with cloud service providers and current cloud users in Oman; and collecting data using questionnaires from experts in the field and potential users of cloud services.
Despite the limitation of bandwidth capacity and Internet coverage offered in Oman that create a challenge in adopting the cloud, it was found that many information technology professionals are encouraged to move to the cloud while few are resistant to change.
The recent launch of a new Omani cloud service provider and the entrance of other international cloud service providers in the Omani market make this research extremely valuable as it aims to provide real-life experience as well as two case studies on the successful provision of cloud services and the successful adoption of these services.
Abstract: Cloud virtualization technologies are becoming more
and more prevalent, cloud users usually encounter the problem of how
to access to the virtualized remote desktops easily over the web
without requiring the installation of special clients. To resolve this
issue, we took advantage of the HTML5 technology and developed
web-based remote desktop. It permits users to access the terminal
which running in our cloud platform from anywhere. We implemented
a sketch of web interface following the cloud computing concept that
seeks to enable collaboration and communication among users for
high performance computing. Given the development of remote
desktop virtualization, it allows to shift the user’s desktop from the
traditional PC environment to the cloud platform, which is stored on a
remote virtual machine rather than locally. This proposed effort has
the potential to positively provide an efficient, resilience and elastic
environment for online cloud service. This is also made possible by the
low administrative costs as well as relatively inexpensive end-user
terminals and reduced energy expenses.
Abstract: The scope of this paper is to evaluate and compare the potential of LS-PV(Large Scale Photovoltaic Power Plant) power generation systems in the southern region of Libya at Al-Kufra for both stationary and tracking systems. A Microsoft Excel-VBA program has been developed to compute slope radiation, dew-point, sky temperature, and then cell temperature, maximum power output and module efficiency of the system for stationary system and for tracking system. The results for energy production show that the total energy output is 114GWh/year for stationary system and 148GWh/year for tracking system. The average module efficiency for the stationary system is 16.6% and 16.2% for the tracking system.
The values of electricity generation capacity factor (CF) and solar capacity factor (SCF) for stationary system were found to be 26% and 62.5% respectively and 34% and 82% for tracking system. The GCR (Ground Cover Ratio) for a stationary system is 0.7, which corresponds to a tilt angle of 24°. The GCR for tracking system was found to be 0.12. The estimated ground area needed to build a 50MW PV plant amounts to approx. 0.55km2 for a stationary PV field constituted by HIT PV arrays and approx. 91MW/ km2. In case of a tracker PV field, the required ground area amounts approx.2.4km2 and approx. 20.5MW/ km2.
Abstract: The extracellular proteins secreted by bacteria may be increased in stressful surroundings, such as in the presence of antibiotics. It appears that many antibiotics, when used at low concentrations, have in common the ability to activate or repress gene transcription, which is distinct from their inhibitory effect. There have been comparatively few studies on the potential of antibiotics as a specific chemical signal that can trigger a variety of biological functions. Therefore, this study was carried out to determine the effect of Streptomycin Sulfate in regulating extracellular proteins secreted by Bacillus subtilis ATCC21332. Results of Microdilution assay showed that the Minimum Inhibition Concentration (MIC) of Streptomycin Sulfate on B. subtilis ATCC21332 was 2.5 mg/ml. The bacteria cells were then exposed to Streptomycin Sulfate at concentration of 0.01 MIC before being further incubated for 48h to 72 h. The extracellular proteins secreted were then isolated and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins profile revealed that three additional bands with approximate sizes of 30 kDa, 22 kDa and 23 kDa were appeared for the treated bacteria with Streptomycin Sulfate. Thus, B. subtilis ATCC21332 in stressful condition with the presence of Streptomycin Sulfate at low concentration could induce the extracellular proteins secretion.
Abstract: Ferulic acid has widespread industrial potential by virtue of its antioxidant properties. However, it is partially soluble in aqueous media, limiting their usefulness in oil-based processes in food, cosmetic, pharmaceutical, and material industry. Therefore, modification of ferulic acid should be made by producing of more lipophilic derivatives. In this study, a preliminary investigation of lipase-catalyzed trans-esterification reaction of ethyl ferulate and olive oil was investigated. The reaction was catalyzed by immobilized lipase from Candida antarctica (Novozym 435), to produce ferulate ester, a sunscreen agent. A statistical approach of Response surface methodology (RSM) was used to evaluate the interactive effects of reaction temperature (40-80°C), reaction time (4-12 hours), and amount of enzyme (0.1-0.5 g). The optimum conditions derived via RSM were reaction temperature 60°C, reaction time 2.34 hours, and amount of enzyme 0.3 g. The actual experimental yield was 59.6% ferulate ester under optimum condition, which compared well to the maximum predicted value of 58.0%.
Abstract: Banana pseudo-stem and fruit-bunch-stem are
agricultural residues that can be used for conversion to bio-char, biooil,
and gases by using thermochemical process. The aim of this work
is to characterize banana pseudo-stem and banana fruit-bunch-stem
through proximate analysis, elemental analysis, chemical analysis,
thermo-gravimetric analysis, and heating calorific value. The ash
contents of the banana pseudo-stem and banana fruit-bunch-stem are
11.0 mf wt.% and 20.6 mf wt.%; while the carbon content of banana
pseudo-stem and fruit-bunch-stem are 37.9 mf wt.% and 35.58 mf
wt.% respectively. The molecular formulas for banana stem and
banana fruit-bunch-stem are C24H33NO26 and C19H29NO33
respectively. The measured higher heating values of banana pseudostem
and banana fruit-bunch-stem are 15.5MJ/kg and 12.7 MJ/kg
respectively. By chemical analysis, the lignin, cellulose, and
hemicellulose contents in the samples will also be presented. The
feasibility of the banana wastes to be a feedstock for thermochemical
process in comparison with other biomass will be discussed in this
paper.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Tidal power can play a vital role in integrating as new source of renewable energy to the off-grid power connection in isolated areas, namely Sandwip, in Bangladesh. It can reduce the present energy crisis and improve the social, environmental and economic perspective of Bangladesh. Tidal energy is becoming popular around the world due to its own facilities. The development of any country largely depends on energy sector improvement. Lack of energy sector is because of hampering progress of any country development, and the energy sector will be stable by only depend on sustainable energy sources. Renewable energy having environmental friendly is the only sustainable solution of secure energy system. Bangladesh has a huge potential of tidal power at different locations, but effective measures on this issue have not been considered sincerely. This paper summarizes the current energy scenario, and Bangladesh can produce power approximately 53.19 MW across the country to reduce the growing energy demand utilizing tidal energy as well as it is shown that Sandwip is highly potential place to produce tidal power, which is estimated approximately 16.49 MW by investing only US $10.37 million. Besides this, cost management for tidal power plant has been also discussed.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Non-synchronous breakage or line failure in power
systems with light or no loads can lead to core saturation in
transformers or potential transformers. This can cause component and
capacitance matching resulting in the formation of resonant circuits,
which trigger ferroresonance. This study employed a wavelet
transform for the detection of ferroresonance. Simulation results
demonstrate the efficacy of the proposed method.
Abstract: In this paper, an analytical study is made for the dynamic behavior of human brain tissue under transient loading. In this analytical model the Mooney-Rivlin constitutive law is coupled with visco-elastic constitutive equations to take into account both the nonlinear and time-dependent mechanical behavior of brain tissue. Five ordinary differential equations representing the relationships of five main parameters (radial stress, circumferential stress, radial strain, circumferential strain, and particle velocity) are obtained by using the characteristic method to transform five partial differential equations (two continuity equations, one motion equation, and two constitutive equations). Analytical expressions of the attenuation properties for spherical wave in brain tissue are analytically derived. Numerical results are obtained based on the five ordinary differential equations. The mechanical responses (particle velocity and stress) of brain are compared at different radii including 5, 6, 10, 15 and 25 mm under four different input conditions. The results illustrate that loading curves types of the particle velocity significantly influences the stress in brain tissue. The understanding of the influence by the input loading cures can be used to reduce the potentially injury to brain under head impact by designing protective structures to control the loading curves types.
Abstract: Experimental Film Class Project is supported by the Institute for Research and Development at Suan Sunandha Rajabhat University. This project is purported to provide academic and professional services to improve the quality standards of the community and locals in accordance with the mission of the university, which is to improve and expand knowledge for the community and to develop and transfer such knowledge and professions to the next generation. Eventually, it leads to sustainable development because the development of human resources is deemed as the key for sustainable development. Moreover, the Experimental Film Class is an integral part of the teaching of film production at Suan Sunandha International School of Art (SISA). By means of giving opportunities to students for participation in projects by sharing experience, skill and knowledge and participation in field activities, it helps students in the film production major to enhance their abilities and potentials as preparation for their readiness in the marketplace. Additionally, in this class, we provide basic film knowledge, screenwriting techniques, editing and subtitles including uploading videos on social media such as YouTube and Facebook for the participant students.
Abstract: The protective effect of hesperidin was investigated in
rats exposed to liver injury induced by a single intraperitoneal
injection of cyclophosphamide (CYP) at a dose of 150 mg kg-1.
Hesperidin treatment (100 mg kg-1/day, orally) was applied for seven
days, starting five days before CYP administration. Hesperidin
significantly decreased the CYP-induced elevations of serum alanine
aminotransferase, and hepatic malondialdehyde and myeloperoxidase
activity, significantly prevented the depletion of hepatic glutathione
peroxidase activity resulted from CYP administration. Also,
hesperidin ameliorated the CYP-induced liver tissue injury observed
by histopathological examination. In addition, hesperidin decreased
the CYP-induced expression of inducible nitric oxide synthase, tumor
necrosis factor-α, cyclooxygenase-2, Fas ligand, and caspase-9 in
liver tissue. It was concluded that hesperidin may represent a
potential candidate to protect against CYP-induced hepatotoxicity.
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.