Abstract: Amyloid aggregation of polypeptides is related to a
growing number of pathologic states known as amyloid disorders. In
recent years, blocking or reversing amyloid aggregation via the use of
small compounds are considered as two useful approaches in
hampering the development of these diseases. In this research, we
have compared the ability of several manganese-salen derivatives, as
synthetic compounds, and apigenin, as a natural flavonoid, to inhibit
of hen egg-white lysozyme (HEWL) aggregation, as an in vitro
model system.
Different spectroscopic analyses such as Thioflavin T (ThT) and
Anilinonaphthalene-8-sulfonic acid (ANS) fluorescence, Congo red
(CR) absorbance along with transmission electron microscopy were
used in this work to monitor the HEWL aggregation kinetic and
inhibition. Our results demonstrated that both type of compounds
were capable to prevent the formation of lysozyme amyloid
aggregation in vitro. In addition, our data indicated that synthetic
compounds had higher activity to inhibit of the β-sheet structures
relative to natural compound. Regarding the higher antioxidant
activities of the salen derivatives, it can be concluded that in addition
to aromatic rings of each of the compounds, the potent antioxidant
properties of salen derivatives contributes to lower lysozyme fibril
accumulation.
Abstract: A vacuum fractionation technique was introduced to remove ethanol from fermentation broth. The effect of initial glucose and ethanol concentrations were investigated for specific productivity. The inhibitory ethanol concentration was observed at 100 g/L. In order to increase the fermentation performance, the ethanol product was removed as soon as it is produced. The broth was boiled at 35oC by reducing the pressure to 65 mBar. The ethanol/water vapor was fractionated for up to 90 wt% before leaving the column. Ethanol concentration in the broth was kept lower than 25 g/L, thus minimized the product inhibition effect to the yeast cells. For batch extractive fermentation, a high substrate utilization rate was obtained at 26.6 g/L.h and most of glucose was consumed within 21 h. For repeated-batch extractive fermentation, addition of glucose was carried out up to 9 times and ethanol was produced more than 8-fold higher than batch fermentation.
Abstract: This paper deals with advanced state estimation algorithms for estimation of biomass concentration and specific growth rate in a typical fed-batch biotechnological process. This biotechnological process was represented by a nonlinear mass-balance based process model. Extended Kalman Filter (EKF) and Particle Filter (PF) was used to estimate the unmeasured state variables from oxygen uptake rate (OUR) and base consumption (BC) measurements. To obtain more general results, a simplified process model was involved in EKF and PF estimation algorithms. This model doesn’t require any special growth kinetic equations and could be applied for state estimation in various bioprocesses. The focus of this investigation was concentrated on the comparison of the estimation quality of the EKF and PF estimators by applying different measurement noises. The simulation results show that Particle Filter algorithm requires significantly more computation time for state estimation but gives lower estimation errors both for biomass concentration and specific growth rate. Also the tuning procedure for Particle Filter is simpler than for EKF. Consequently, Particle Filter should be preferred in real applications, especially for monitoring of industrial bioprocesses where the simplified implementation procedures are always desirable.
Abstract: Partial shadowing is one of the problems that are always faced in terrestrial applications of solar photovoltaic (PV). The effects of partial shadow on the energy yield of conventional mono-crystalline and multi-crystalline PV modules have been researched for a long time. With deployment of new thin-film solar PV modules in the market, it is important to understand the performance of new PV modules operating under the partial shadow in the tropical zone. This paper addresses the impacts of different partial shadowing on the operating characteristics of four different types of solar PV modules that include multi-crystalline, amorphous thin-film, CdTe thin-film and CIGS thin-film PV modules.
Abstract: With growth of PV market in tropical region, it is necessary to investigate the performance of different types of PV technology under the tropical weather conditions. Singapore Polytechnic was funded by Economic Development Board (EDB) to set up a solar PV test-bed for the research on performance of different types of PV modules in the country. The PV test-bed installed the nine different types of PV systems that are integrated to power utility grid for monitoring and analyzing their operating performances. This paper presents the 12 months operational data of nine different PV systems and analyses on performances of installed PV systems using energy yield and performance ratio. The nine types of PV systems under test have shown their energy yields ranging from 2.67 to 3.36 kWh/kWp and their performance ratios (PRs) ranging from 70% to 88%.
Abstract: The research about Formal Thai National Costume in the reign of King Bhumibol Adulyadej is an applied research that aimed to study the accurate knowledge concerning to Thai national costume in the reign of King Rama IX, also to study origin of all costumes in the reign of King Rama IX and to study the style, material used, and using accasion. This research methodology which are collect quanlitative data through observation, document, and photograph from key informant of costume in the reign of King Rama IX and from another who related to this field.
The formal Thai national costume of the reign of King Bhumibol Adulyadej originated from the visit of His Majesty the King to Europe and America in 1960. Since Thailand had no traditional national costume; Her Majesty the Queen initiated the idea to create formal Thai national costumes. In 1964, Her Majesty the Queen selected 8 styles of formal Thai national costume. Later, Her Majesty the Queen confered another 3 formal Thai national costume for men. There are 8 styles of formal Thai national costume for women: Thai Ruean Ton, Thai Chit Lada, Thai Amarin, Thai Borom Phiman, Thai Siwalia, Thai Chakkri, Thai Dusit, and Thai Chakkraphat. There are 3 styles of formal Thai national costume for men: short-sleeve shirt, long-sleeve shirt, and long-sleeve shirt with breechcloth. The costume is widely used in formal ceremony such as greeting ceremony for official foreign visitors, wedding ceremony, or other auspicious ceremonies. Now a day, they are always used as a bridal gown as well. The formal Thai national costume is valuable art that shows Thai identity and, should be preserved for the next generation.
Abstract: Virtual reality (VR) is a rapidly emerging computer
interface that attempts to immerse the user completely within an
experimental recreation; thereby, greatly enhancing the overall
impact and providing a much more intuitive link between the
computer and the human participants. The main objective of this
study is to design tractor trailer capable of meeting the customers’
requirements and suitable for rough conditions to be used in
combination with a farm tractor in India. The final concept is capable
of providing arrangements for attaching the trailer to the tractor easily
by pickup hitch, stronger and lighter supporting frame, option of
spare tyre etc. Furthermore, the resulting product design can be sent
via the Internet to customers for comments or marketing purposes.
The virtual prototyping (VP) system therefore facilitates advanced
product design and helps reduce product development time and cost
significantly.
Abstract: The analysis and design of thin shell structures is a topic of interest in a variety of engineering applications. In structural mechanics problems the analyst seeks to determine the distribution of stresses throughout the structure to be designed. It is also necessary to calculate the displacements of certain points of the structure to ensure that specified allowable values are not exceeded. In this paper a comparative study between displacement and strain based finite elements applied to the analysis of some thin shell structures is presented. The results obtained from some examples show the efficiency and the performance of the strain based approach compared to the well known displacement formulation.
Abstract: Solid lipid nanoparticles (SLNs) have gained great attention for the topical treatment of skin associated fungal infection as they facilitate the skin penetration of loaded drugs. Our work deals with the preparation of nystatin loaded solid lipid nanoparticles (NystSLNs) using the hot homogenization and ultrasonication method. The prepared NystSLNs were characterized in terms of entrapment efficiency, particle size, zeta potential, transmission electron microscopy, differential scanning calorimetry, rheological behavior and in vitro drug release. A stability study for 6 months was performed. A microbiological study was conducted in male rats infected with Candida albicans, by counting the colonies and examining the histopathological changes induced on the skin of infected rats. The results showed that SLNs dispersions are spherical in shape with particle size ranging from 83.26±11.33 to 955.04±1.09 nm. The entrapment efficiencies are ranging from 19.73±1.21 to 72.46±0.66% with zeta potential ranging from -18.9 to -38.8 mV and shear-thinning rheological Behavior. The stability studies done for 6 months showed that nystatin (Nyst) is a good candidate for topical SLN formulations. A least number of colony forming unit/ ml (cfu/ml) was recorded for the selected NystSLN compared to the drug solution and the commercial Nystatin® cream present in the market. It can be fulfilled from this work that SLNs provide a good skin targeting effect and may represent promising carrier for topical delivery of Nyst offering the sustained release and maintaining the localized effect, resulting in an effective treatment of cutaneous fungal infection.
Abstract: In recent years, many researchers are involved in the
field of fuzzy theory. However, there are still a lot of issues to be
resolved. Especially on topics related to controller design such as the
field of robot, artificial intelligence, and nonlinear systems etc.
Besides fuzzy theory, algorithms in swarm intelligence are also a
popular field for the researchers. In this paper, a concept of utilizing
one of the swarm intelligence method, which is called Bacterial-GA
Foraging, to find the stabilized common P matrix for the fuzzy
controller system is proposed. An example is given in in the paper, as
well.
Abstract: Flanges are widely used for connecting valves, pipes and other industrial devices such as gearboxes. Method of producing a flange has a considerable impact on the manner of their involvement with the industrial engines and gearboxes. By Using die casting instead of sand casting and machining for manufacturing flanges, production speed and dimensional accuracy of the parts increases. Also, in die casting, obtained dimensions are close to final dimensions and hence the need for machining flanges after die casting process decreases which makes a significant savings in raw materials and improves the mechanical properties of flanges. In this paper, a typical die of an industrial helical gearbox flange (size ISO 50) was designed and die casting process for producing this type of flange was simulated using ProCAST software. The results of simulation were used for optimizing die design. Finally, using the results of the analysis, optimized die was built.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.
Abstract: CNFET has emerged as an alternative material to
silicon for high performance, high stability and low power SRAM
design in recent years. SRAM functions as cache memory in
computers and many portable devices. In this paper, a new SRAM
cell design based on CNFET technology is proposed. The proposed
SRAM cell design for CNFET is compared with SRAM cell designs
implemented with the conventional CMOS and FinFET in terms of
speed, power consumption, stability, and leakage current. The
HSPICE simulation and analysis show that the dynamic power
consumption of the proposed 8T CNFET SRAM cell’s is reduced
about 48% and the SNM is widened up to 56% compared to the
conventional CMOS SRAM structure at the expense of 2% leakage
power and 3% write delay increase.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: Small and medium-sized enterprises (SME) are the backbone of central Europe’s economies and have a significant contribution to the gross domestic product. Production planning and scheduling (PPS) is still a crucial element in manufacturing industries of the 21st century even though this area of research is more than a century old. The topic of PPS is well researched especially in the context of large enterprises in the manufacturing industry. However the implementation of PPS methodologies within SME is mostly unobserved. This work analyzes how PPS is implemented in SME with the geographical focus on Switzerland and its vicinity. Based on restricted resources compared to large enterprises, SME have to face different challenges. The real problem areas of selected enterprises in regards of PPS are identified and evaluated. For the identified real-life problem areas of SME clear and detailed recommendations are created, covering concepts and best practices and the efficient usage of PPS. Furthermore the economic and entrepreneurial value for companies is lined out and why the implementation of the introduced recommendations is advised.
Abstract: Negotiation is a specific form of interaction based on communication in which the parties enter into deliberately, each with clear but different interests or goals and a mutual dependency towards a decision due to be taken at the end of the confrontation. Consequently, negotiation is a complex activity involving many different disciplines from the strategic aspects and the decision making process to the evaluation of alternatives or outcomes and the exchange of information. While gender differences can be considered as one of the most researched topic within negotiation studies, empirical works and theory present many conflicting evidences and results about the role of gender in the process or the outcome. Furthermore, little interest has been shown over gender differences in the definition of what is negotiation, its essence or fundamental elements. Or, as differences exist in practices, it might be essential to study if the starting point of these discrepancies does not come from different considerations about what is negotiation and what will encourage the participants in their strategic decisions. Some recent and promising experiments made with diverse groups show that male and female participants in a common and shared situation barely consider the same way the concepts of power, trust or stakes which are largely considered as the usual driving forces of any negotiation. Furthermore, results from Human Resource self-assessment tests display and confirm considerable differences between individuals regarding essential behavioral dimensions like capacity to improvise and to achieve, aptitude to conciliate or to compete and orientation towards power and group domination which are also part of negotiation skills. Our intention in this paper is to confront these dimensions with negotiation’s usual driving forces in order to build up new paths for further research.
Abstract: The study aimed to collect morphological data of
secretory structures that contribute to taxonomy of Indigofera. Detail
features of trichomes occurrence in vegetative and reproductive
organs of Indigofera wightii Grah. ex Wigh & Arn., a species
traditionally used as source of indigo to dye “Thaisongdam” clothing
were investigated. Examination through light microscopy and
scanning electrom microscopy were done. Non secretory, T-shaped
trichomes appeared throughout surfaces of stems, leaves, flowers and
fruits. Secretory or glandular trichomes occurred in two types; one
has big cylindrical head and short peduncle, distributed on adaxial
surface of sepals and around the pedicel, whereas another possesses
smaller cylindrical head but long peduncle. The latter was found on
apical surface of immature pods. No phenolic and lipophilic
compounds were detected from these glands.
Abstract: Gypsum is being applied to ameliorate subsoil acidity and to overcome the problem of very slow lime movement from surface lime applications. Reduced Crude Conversion Spent Lime (RCCSL) containing anhydrite was evaluated for use as a liming material with specific consideration given to the movement of sulfate into the acid subsoil. Agricultural lime and RCCSL were applied at 0, 0.5, 1.0, and 1.5 times the lime requirement of 6.72 Mg ha-1 to an acid Trappist silt loam (TypicHapuldult). Corn [Zea mays (L.)]was grown following lime material application and soybean [Glycine max (L.) Merr.]was grown in the second year.Soil pH increased rapidly with the addition of the RCCSL material. Over time there was no difference in soil pH between the materials but there was with increasing rate. None of the observed changes in plant nutrient concentration had an impact on yield. Grain yield was higher for the RCCSL amended treatments in the first year but not in the second. There was a significant increase in soybean grain yield from the full lime requirement treatments over no lime.
Abstract: The purpose of this study was to address and comparison of the attitudes towards the statistics course for undergraduate students. Data were collected from 120 students in Faculty of Sciences and Technology, Suan Sunandha Rajabhat University who enrolled in the statistics course. The quantitative approach was used to investigate the assessment and comparison of attitudes towards statistics course. It was revealed that the overall attitudes somewhat agree both in pre-test and post-test. In addition, the comparison of students’ attitudes towards the statistic course (Form A) has no difference in the overall attitudes. However, there is statistical significance in all dimensions and overall attitudes towards the statistics course (Form B).