Abstract: In this paper the vibration of a synchronous belt drive
during start-up is analyzed and discussed. Besides considering the
belt elasticity, the model here proposed also takes into consideration
the electromagnetic response of the DC motor. The solution of the
motion equations is obtained by means of the modal analysis in
state space, which allows to obtain the decoupling of all equations,
without introducing the hypothesis of proportional damping. The
mathematical model of the transmission and the solution algorithms
have been implemented within a computing software that allows the
user to simulate the dynamics of the system and to evaluate the effects
due to the elasticity of the belt branches and to the electromagnetic
behavior of the DC motor. In order to show the details of the
calculation procedure, the paper presents a case study developed with
the aid of the above-mentioned software.
Abstract: Analytical expressions of the current and angular errors, as well as the frequency characteristics of an induction converter describing the relation with its structural parameters, the core and winding characteristics are obtained. Based on estimation of the dependences obtained, a mathematical problem of parametric optimization is formulated which can successfully be used for investigating and diagnosing an induction converter.
Abstract: Current transformers (CTs) are used to transform large primary currents to a small secondary current. Since most standard equipment’s are not designed to handle large primary currents the CTs have an important part in any electrical system for the purpose of Metering and Protection both of which are integral in Power system. Now a days due to advancement in solid state technology, the operation times of the protective relays have come to a few cycles from few seconds. Thus, in such a scenario it becomes important to study the transient response of the current transformers as it will play a vital role in the operating of the protective devices.
This paper shows the steady state and transient behavior of current transformers and how it changes with change in connected burden. The transient and steady state response will be captured using the data acquisition software LabVIEW. Analysis is done on the real time data gathered using LabVIEW. Variation of current transformer characteristics with changes in burden will be discussed.
Abstract: In this paper we introduce a bacteria-leukocyte model
with bacteria chemotaxsis. We assume that bacteria develop a tactic
defence mechanism as a response to Leukocyte phagocytosis. We
explore the effect of this tactic motion on Turing space in two
parameter spaces. A fine tuning of bacterial chemotaxis shows a
significant effect on developing a non-uniform steady state.
Abstract: Data Grid is a geographically distributed environment that deals with data intensive application in scientific and enterprise computing. Data replication is a common method used to achieve efficient and fault-tolerant data access in Grids. In this paper, a dynamic data replication strategy, called Enhanced Latest Access Largest Weight (ELALW) is proposed. This strategy is an enhanced version of Latest Access Largest Weight strategy. However, replication should be used wisely because the storage capacity of each Grid site is limited. Thus, it is important to design an effective strategy for the replication replacement task. ELALW replaces replicas based on the number of requests in future, the size of the replica, and the number of copies of the file. It also improves access latency by selecting the best replica when various sites hold replicas. The proposed replica selection selects the best replica location from among the many replicas based on response time that can be determined by considering the data transfer time, the storage access latency, the replica requests that waiting in the storage queue and the distance between nodes. Simulation results utilizing the OptorSim show our replication strategy achieve better performance overall than other strategies in terms of job execution time, effective network usage and storage resource usage.
Abstract: The sound pressure level (SPL) of the moving-coil
loudspeaker (MCL) is often simulated and analyzed using the lumped
parameter model. However, the SPL of a MCL cannot be simulated
precisely in the high frequency region, because the value of cone
effective area is changed due to the geometry variation in different
mode shapes, it is also related to affect the acoustic radiation mass and
resistance. Herein, the paper presents the inverse method which has a
high ability to measure the value of cone effective area in various
frequency points, also can estimate the MCL electroacoustic
parameters simultaneously. The proposed inverse method comprises
the direct problem, adjoint problem, and sensitivity problem in
collaboration with nonlinear conjugate gradient method. Estimated
values from the inverse method are validated experimentally which
compared with the measured SPL curve result. Results presented in
this paper not only improve the accuracy of lumped parameter model
but also provide the valuable information on loudspeaker cone design.
Abstract: This study presents the numerical simulation of three-dimensional incompressible steady and laminar fluid flow and conjugate heat transfer of a trapezoidal microchannel heat sink using water as a cooling fluid in a silicon substrate. Navier-Stokes equations with conjugate energy equation are discretized by finite-volume method. We perform numerical computations for a range of 50 ≦ Re ≦ 600, 0.05W ≦ P ≦ 0.8W, 20W/cm2 ≦q"≦ 40W/cm2. The present study demonstrates the numerical optimization of a trapezoidal microchannel heat sink design using the response surface methodology (RSM) and the genetic algorithm method (GA). The results show that the average Nusselt number increases with an increase in the Reynolds number or pumping power, and the thermal resistance decreases as the pumping power increases. The thermal resistance of a trapezoidal microchannel is minimized for a constant heat flux and constant pumping power.
Abstract: The impact deformation and fracture behaviour of cobalt-based Haynes 188 superalloy are investigated by means of a split Hopkinson pressure bar. Impact tests are performed at strain rates ranging from 1×103 s-1 to 5×103 s-1 and temperatures between 25°C and 800°C. The experimental results indicate that the flow response and fracture characteristics of cobalt-based Haynes 188 superalloy are significantly dependent on the strain rate and temperature. The flow stress, work hardening rate and strain rate sensitivity all increase with increasing strain rate or decreasing temperature. It is shown that the impact response of the Haynes 188 specimens is adequately described by the Zerilli-Armstrong fcc model. The fracture analysis results indicate that the Haynes 188 specimens fail predominantly as the result of intensive localised shearing. Furthermore, it is shown that the flow localisation effect leads to the formation of adiabatic shear bands. The fracture surfaces of the deformed Haynes 188 specimens are characterised by dimple- and / or cleavage-like structure with knobby features. The knobby features are thought to be the result of a rise in the local temperature to a value greater than the melting point.
Abstract: In this paper, the design of a coaxial feed single layer rectangular microstrip patch antenna for three different wireless communication band applications is presented. The proposed antenna is designed by using substrate Roger RT/duroid 5880 having permittivity of about 2.2 and tangent loss of 0.0009. The characteristics of the substrate are designed and to evaluate the performance of modeled antenna using HFSS v.11 EM simulator, from Ansoft. The proposed antenna has small in size and operates at 2.25GHz, 3.76GHz and 5.23GHz suitable for mobile satellite service (MSS) network, WiMAX and WLAN applications. The dimension of the patch and slots are optimized to obtain these desired functional frequency ranges. The simulation results with frequency response, radiation pattern and return loss, VSWR, Input Impedance are presented with appropriate table and graph.
Abstract: Background: The high prevalence of obesity in Egypt has a great impact on the health care system, economic and social situation. Evidence suggests that even a moderate amount of weight loss can be useful. Aim of the study: To analyze the effects of lower body positive pressure supported treadmill training, conducted with hypocaloric diet, on body composition of obese children. Methods: Thirty children aged between 8 and 14 years, were randomly assigned into two groups: intervention group (15 children) and control group (15 children). All of them were evaluated using body composition analysis through bioelectric impedance. The following parameters were measured before and after the intervention: body mass, body fat mass, muscle mass, body mass index (BMI), percentage of body fat and basal metabolic rate (BMR). The study group exercised with antigravity treadmill three times a week during 2 months, and participated in a hypocaloric diet program. The control group participated in a hypocaloric diet program only. Results: Both groups showed significant reduction in body mass, body fat mass and BMI. Only study group showed significant reduction in percentage of body fat (p = 0.0.043). Changes in muscle mass and BMR didn't reach statistical significance in both groups. No significant differences were observed between groups except for muscle mass (p = 0.049) and BMR (p = 0.042) favoring study group. Conclusion: Both programs proved effective in the reduction of obesity indicators, but lower body positive pressure supported treadmill training was more effective in improving muscle mass and BMR.
Abstract: Ferulic acid has widespread industrial potential by virtue of its antioxidant properties. However, it is partially soluble in aqueous media, limiting their usefulness in oil-based processes in food, cosmetic, pharmaceutical, and material industry. Therefore, modification of ferulic acid should be made by producing of more lipophilic derivatives. In this study, a preliminary investigation of lipase-catalyzed trans-esterification reaction of ethyl ferulate and olive oil was investigated. The reaction was catalyzed by immobilized lipase from Candida antarctica (Novozym 435), to produce ferulate ester, a sunscreen agent. A statistical approach of Response surface methodology (RSM) was used to evaluate the interactive effects of reaction temperature (40-80°C), reaction time (4-12 hours), and amount of enzyme (0.1-0.5 g). The optimum conditions derived via RSM were reaction temperature 60°C, reaction time 2.34 hours, and amount of enzyme 0.3 g. The actual experimental yield was 59.6% ferulate ester under optimum condition, which compared well to the maximum predicted value of 58.0%.
Abstract: This study aim at the influence of college students’ exercise and leisure motivations on the leisure benefits while using the leisure involvement as a moderator. Whereby, the research tools used in this study included the application of leisure motivation scale, leisure involvement scale and leisure benefits scale, and a hierarchical regression analysis was performed by using a questionnaire-based survey, in which, a total of 1,500 copies of questionnaires were administered and 917 valid questionnaires were obtained, achieving a response rate of 61.13%. Research findings explore that leisure involvement has a moderating effect on the relationship between the leisure motivation and leisure benefits.
Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: In this paper, a fifth order propagator operators are proposed for estimating the Angles Of Arrival (AOA) of narrowband electromagnetic waves impinging on antenna array when its number of sensors is larger than the number of radiating sources.
The array response matrix is partitioned into five linearly dependent phases to construct the noise projector using five different propagators from non diagonal blocks of the spectral matrice of the received data; hence, five different estimators are proposed to estimate the angles of the sources. The simulation results proved the performance of the proposed estimators in the presence of white noise comparatively to high resolution eigen based spectra.
Abstract: Purpose: This E-survey was carried out to facilitate the implementation and Education of VMAT (Volumetric Modulated Arc Therapy) in Radiotherapy-RT departments and reasons for not using IMRT (Intensity Modulated Radiotherapy). VMAT Skills in demand were also identified. Method: E-Survey was distributed to NHS hospitals across UK by email. Thirty NHS and related centres in England, 21 in Scotland, 3 in Ireland and 1 in Wales were contacted. This Survey was intended for those working in RT and Medical Physics and who were responsible for Treatment Planning and training. Results: This E-survey have indicated pathways adopted by staff to acquire VMAT skills, strategies to efficiently implement VMAT in RT departments and for obtaining VMAT Education. Conclusion: Despite poor survey response this survey has managed to highlight requirements for education and implementation of VMAT that are also applicable to IMRT. Other RT centres in world can also find these results useful.
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: In this paper, an analytical study is made for the dynamic behavior of human brain tissue under transient loading. In this analytical model the Mooney-Rivlin constitutive law is coupled with visco-elastic constitutive equations to take into account both the nonlinear and time-dependent mechanical behavior of brain tissue. Five ordinary differential equations representing the relationships of five main parameters (radial stress, circumferential stress, radial strain, circumferential strain, and particle velocity) are obtained by using the characteristic method to transform five partial differential equations (two continuity equations, one motion equation, and two constitutive equations). Analytical expressions of the attenuation properties for spherical wave in brain tissue are analytically derived. Numerical results are obtained based on the five ordinary differential equations. The mechanical responses (particle velocity and stress) of brain are compared at different radii including 5, 6, 10, 15 and 25 mm under four different input conditions. The results illustrate that loading curves types of the particle velocity significantly influences the stress in brain tissue. The understanding of the influence by the input loading cures can be used to reduce the potentially injury to brain under head impact by designing protective structures to control the loading curves types.
Abstract: Hand grip strength has been utilized as an indicator to evaluate the motor ability of hands, responsible for performing multiple body functions. It is, however, difficult to evaluate other factors (other than hand muscular strength) utilizing the hand grip strength only. In this study, we analyzed the motor ability of hands using EMG and the hand grip strength, simultaneously in order to evaluate concentration, muscular strength reaction time, instantaneous muscular strength change, and agility in response to visual reaction. In results, the average time (and their standard deviations) of muscular strength reaction EMG signal and hand grip strength was found to be 209.6 ± 56.2 ms and 354.3 ± 54.6 ms, respectively. In addition, the onset time which represents acceleration time to reach 90% of maximum hand grip strength, was 382.9 ± 129.9 ms.
Abstract: A novel technique has been developed to generate ultra-stable millimeter-wave signal by optical heterodyning of the output from two slave laser (SL) sources injection-locked to the sidebands of a frequency modulated (FM) master laser (ML). Precise thermal tuning of the SL sources is required to lock the particular slave laser frequency to the desired FM sidebands of the ML. The output signals from the injection-locked SL when coherently heterodyned in a fast response photo detector like high electron mobility transistor (HEMT), extremely stable millimeter-wave signal having very narrow line width can be generated. The scheme may also be used to generate ultra-stable sub-millimeter-wave/terahertz signal.