Abstract: This research aimed to study on the efficiency of wastewater treatment by comparing the different aeration times of surface aerators in Suan Sunandha Rajabhat University. In doing so, the operation of surface aerators was divided into 2 groups which included the groups of 8 hours (8-0/opened-closed) and 4 hours (2-2/opened-closed) of aeration time per day. As a result of the study, it was found that the efficiency of wastewater treatment in the forms of DO, BOD, turbidity and NO2- by 8 hours (8-0/opened-closed) and 4 hours (2-2/opened-closed) of aeration time per day of surface aerators was not statistically different [Sig. = .644, .488, .716 and .054 > α (.05)] while the efficiency in the forms of NO3- and P was significantly different at the statistical level of .01 [Sig. = .001 and .000 < α (.01)].
Abstract: The Ballast Water Convention requires less than 5% of the world tonnage for ratification. Consequently, ships will have to comply with the requirements. Compliance evaluation and enforcement will become mandatory. Ship owners have to invest in treatment systems and shipboard personnel have to operate them and ensure compliance. The monitoring and enforcement will be the responsibilities of the Administrations. Herein, a review of the current status of the Ballast Water Management and the issues faced by these are projected. Issues range from efficacy and economics of the treatment systems to sampling and testing. Health issues of chemical systems, paucity of data for decision support etc., are other issues. It is emphasized that management of ballast water must be extended to ashore and sustainable solutions must be researched upon. An exemplar treatment system based on ship’s waste heat is also suggested.
Abstract: Solid lipid nanoparticles (SLNs) have gained great attention for the topical treatment of skin associated fungal infection as they facilitate the skin penetration of loaded drugs. Our work deals with the preparation of nystatin loaded solid lipid nanoparticles (NystSLNs) using the hot homogenization and ultrasonication method. The prepared NystSLNs were characterized in terms of entrapment efficiency, particle size, zeta potential, transmission electron microscopy, differential scanning calorimetry, rheological behavior and in vitro drug release. A stability study for 6 months was performed. A microbiological study was conducted in male rats infected with Candida albicans, by counting the colonies and examining the histopathological changes induced on the skin of infected rats. The results showed that SLNs dispersions are spherical in shape with particle size ranging from 83.26±11.33 to 955.04±1.09 nm. The entrapment efficiencies are ranging from 19.73±1.21 to 72.46±0.66% with zeta potential ranging from -18.9 to -38.8 mV and shear-thinning rheological Behavior. The stability studies done for 6 months showed that nystatin (Nyst) is a good candidate for topical SLN formulations. A least number of colony forming unit/ ml (cfu/ml) was recorded for the selected NystSLN compared to the drug solution and the commercial Nystatin® cream present in the market. It can be fulfilled from this work that SLNs provide a good skin targeting effect and may represent promising carrier for topical delivery of Nyst offering the sustained release and maintaining the localized effect, resulting in an effective treatment of cutaneous fungal infection.
Abstract: Castor (Ricinus communis L.) is one of the important
non-edible oilseed crops having immense industrial and medicinal
value. Oil yield per unit area is the ultimate target in growing oilseed
plants and sowing date is one of the important factors which have a
clear role on production of active substances particularly in oilseeds.
This study was conducted to evaluate the effect of sowing date on the
seed and oil yield of castor in Central Anatolia of Turkey in 2011.
The field experiment was set up in a completely randomized block
design with three replications. Black Diamond-2 castor cultivar was
used as plant material. The treatment was four sowing dates of May
10, May 25, June 10, June 25. In this research; seed yield, oil content
and oil yield were investigated. Results showed that the effect of
different sowing dates were significant on all of characteristics. In
general; delayed sowing dates, resulted in decreased seed yield, oil
content and oil yield. The highest value of seed yield, oil content and
oil yield (respectively, 2523.7 kg ha-1, 51.18% and 1292.2 kg ha-1)
were obtained from the first sowing date (May 10) while the lowest
seed yield, oil content and oil yield (respectively, 1550 kg ha-1,
43.67%, 677.3 kg ha-1) were recorded from the latest sowing date
(June 25). Therefore, it can be concluded that early May could be
recommended as an appropriate sowing date in the studied location
and similar climates for achieved high oil yield of castor.
Abstract: The acidity (citric acid) is the one of chemical content that can be refer to the internal quality and it’s a maturity index of tomato, The titratable acidity (%TA) can be predicted by a non-destructive method prediction by using the transmittance short wavelength (SW-NIR) spectroscopy in the wavelength range between 665-955 nm. The set of 167 tomato samples divided into groups of 117 tomatoes sample for training set and 50 tomatoes sample for test set were used to establish the calibration model to predict and measure %TA by partial least squares regression (PLSR) technique. The spectra were pretreated with MSC pretreatment and it gave the optimal result for calibration model as (R = 0.92, RMSEC = 0.03%) and this model obtained high accuracy result to use for %TA prediction in test set as (R = 0.81, RMSEP = 0.05%). From the result of prediction in test set shown that the transmittance SW-NIR spectroscopy technique can be used for a non-destructive method for %TA prediction of tomato.
Abstract: A meta-analysis may be performed using aggregate data (AD) or an individual patient data (IPD). In practice, studies may be available at both IPD and AD level. In this situation, both the IPD and AD should be utilised in order to maximize the available information. Statistical advantages of combining the studies from different level have not been fully explored. This study aims to quantify the statistical benefits of including available IPD when conducting a conventional summary-level meta-analysis. Simulated meta-analysis were used to assess the influence of the levels of data on overall meta-analysis estimates based on IPD-only, AD-only and the combination of IPD and AD (mixed data, MD), under different study scenario. The percentage relative bias (PRB), root mean-square-error (RMSE) and coverage probability were used to assess the efficiency of the overall estimates. The results demonstrate that available IPD should always be included in a conventional meta-analysis using summary level data as they would significantly increased the accuracy of the estimates.On the other hand, if more than 80% of the available data are at IPD level, including the AD does not provide significant differences in terms of accuracy of the estimates. Additionally, combining the IPD and AD has moderating effects on the biasness of the estimates of the treatment effects as the IPD tends to overestimate the treatment effects, while the AD has the tendency to produce underestimated effect estimates. These results may provide some guide in deciding if significant benefit is gained by pooling the two levels of data when conducting meta-analysis.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Purpose: This E-survey was carried out to facilitate the implementation and Education of VMAT (Volumetric Modulated Arc Therapy) in Radiotherapy-RT departments and reasons for not using IMRT (Intensity Modulated Radiotherapy). VMAT Skills in demand were also identified. Method: E-Survey was distributed to NHS hospitals across UK by email. Thirty NHS and related centres in England, 21 in Scotland, 3 in Ireland and 1 in Wales were contacted. This Survey was intended for those working in RT and Medical Physics and who were responsible for Treatment Planning and training. Results: This E-survey have indicated pathways adopted by staff to acquire VMAT skills, strategies to efficiently implement VMAT in RT departments and for obtaining VMAT Education. Conclusion: Despite poor survey response this survey has managed to highlight requirements for education and implementation of VMAT that are also applicable to IMRT. Other RT centres in world can also find these results useful.
Abstract: The protective effect of hesperidin was investigated in
rats exposed to liver injury induced by a single intraperitoneal
injection of cyclophosphamide (CYP) at a dose of 150 mg kg-1.
Hesperidin treatment (100 mg kg-1/day, orally) was applied for seven
days, starting five days before CYP administration. Hesperidin
significantly decreased the CYP-induced elevations of serum alanine
aminotransferase, and hepatic malondialdehyde and myeloperoxidase
activity, significantly prevented the depletion of hepatic glutathione
peroxidase activity resulted from CYP administration. Also,
hesperidin ameliorated the CYP-induced liver tissue injury observed
by histopathological examination. In addition, hesperidin decreased
the CYP-induced expression of inducible nitric oxide synthase, tumor
necrosis factor-α, cyclooxygenase-2, Fas ligand, and caspase-9 in
liver tissue. It was concluded that hesperidin may represent a
potential candidate to protect against CYP-induced hepatotoxicity.
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.
Abstract: This study was aimed to investigate the effect of
various organic supplements on growth and development of
Dendrobium discolor’s protocorms and seedlings growth of
Dendrobium Judy Rutz. Protocorms of Dendrobium discolor with 2.0
cm. in diameter and seedlings of Dendrobium Judy Rutz at the same
size (0.5 cm. height) were sub-cultured on Hyponex medium
supplemented with cow milk (CM), soy milk (SM), potato extract
(PE) and peptone (P) for 2 months. The protocorms were developed
to seedlings in all treatments after cultured for 2 months. However,
the best results were found on Hyponex medium supplemented with
P was the best in which the maximum fresh and dry weight and
maximum shoot height were obtained in this treatment statistically
different (p ≤ 0.05) to other treatments. Moreover, Hyponex medium
supplemented with P also stimulated the maximum mean number of
5.7 shoots per explant which also showed statistically different (p ≤
0.05) when compared to other treatments. The results of growth of
Dendrobium Judy Rutz seedlings indicated the medium
supplemented with 100 mL/L PE enhanced the maximum fresh and
dry weigh per explants with significantly different (p ≤ 0.05) in fresh
weight from other treatments including the control medium without
any organic supplementation. However, the dry weight was not
significantly different (p ≤ 0.05) from medium supplemented with
SM and P. There was multiple shoots induction in all media with or
without organic supplementation ranging from 2.6 to 3 shoots per
explants. The maximum shoot height was also obtained in the
seedlings cultured on medium supplemented with PE while the
longest root length was found in medium supplemented with SM.
Abstract: This study aimed to investigate effect of different organic supplements on growth of Vanda and Mokara seedlings. Vanda and Mokara seedlings approximately 0.2 and 0.3 cm. in height were sub-cultured onto VW supplemented with 150 ml/L coconut water, 100 g/L potato extract, 100 g/L ‘Gros Michel’ banana (AAA group) and 100 g/L ‘Namwa’ banana (ABB group). The explants were sub-cultured onto the same medium every month for 3 months. The best medium increased stem height to 0.52 and 0.44 Cm. in Vanda and Mokara respectively was supplemented with coconut water. The maximum fresh weight of Vanda (0.59 g) was found on medium supplemented with ‘Gros Michel’ banana while Mokara cultured on medium supplemented with Potato extract had the maximum fresh weight (0.27 g) and number of roots (5.20 roots/shoot) statistically different (p≤ 0.05) to other treatments. However, Vanda cultured on medium supplemented with ‘Namwa’ banana had the maximum number of roots (3.80 roots/shoot). Our results suggested that growth of different orchid genera was responded diversely to different organic supplements.
Abstract: A hydroponic trial was carried out to investigate the effect of molybdenum (Mo) on uptake of phosphorus (P) in different rice cultivars. The experiment was conducted using a randomized complete-block design, with a split-plot arrangement of treatments and three replications. Four rates of Mo (0, 0.01, 0.1 and 1 mg L−1) and five cultivars (MR219, HASHEMI, MR232, FAJRE and MR253) provided the main and sub-plots, respectively. Interaction of molybdenum×variety was significant on shoot phosphorus uptake (p≤0.01). Highest and lowest shoot phosphorus uptake were seen in Mo3V3 (0.6% plant-1) and Mo0V3 (0.14% plant-1) treatments, respectively. Molybdenum did not have a significant effect on root phosphorus content. According to results, application of molybdenum has a synergistic effect on uptake of phosphorus by rice plants.
Abstract: Gypsum is being applied to ameliorate subsoil acidity and to overcome the problem of very slow lime movement from surface lime applications. Reduced Crude Conversion Spent Lime (RCCSL) containing anhydrite was evaluated for use as a liming material with specific consideration given to the movement of sulfate into the acid subsoil. Agricultural lime and RCCSL were applied at 0, 0.5, 1.0, and 1.5 times the lime requirement of 6.72 Mg ha-1 to an acid Trappist silt loam (TypicHapuldult). Corn [Zea mays (L.)]was grown following lime material application and soybean [Glycine max (L.) Merr.]was grown in the second year.Soil pH increased rapidly with the addition of the RCCSL material. Over time there was no difference in soil pH between the materials but there was with increasing rate. None of the observed changes in plant nutrient concentration had an impact on yield. Grain yield was higher for the RCCSL amended treatments in the first year but not in the second. There was a significant increase in soybean grain yield from the full lime requirement treatments over no lime.
Abstract: We used 24 Ile de France lambs, weighing between 15 and 32 kg (BW). Treatments were supplemented with concentrate: “in nature” sugarcane (IN), sugarcane hydrolyzed using 0.6% calcium oxide (CaO) under aerobic condition (AER), and sugarcane hydrolyzed using 0.6% CaO under anaerobic condition (ANA), constituting a completely randomized design with eight repetitions per treatment. Lambs were housed in individual stalls and fed into the through, allowing 10% of leftovers. Lambs were slaughtered when body weight reached 32 kg. The following parameters were determined on Longissimu lumborum muscle of hot and cold carcasses: pH and color, 45 minutes and 24 hours after slaughtering. Qualitative analysis of the meat were performed in the loins, water-holding capacity (WHC), cooking loss (CL), and shear force (SF). We used a completely randomized design with three treatments and eight repetitions. Means were compared by Tukey test at 5% significance. A higher value for redness (a*) 45 minutes after slaughter (10.48) were found for lambs fed hydrolyzed under anaerobic conditions sugarcane. The other qualitative characteristics of meat were not affected by treatments (P >0.05). The comparison of meat quality resulting from the treatments shows that it is possible to feed in nature sugarcane to lambs, thus waiving hydrolyses process and the spending with alkalizing agent.
Abstract: This research aims to create a knowledge-based system as a database for self-healthcare analysis, diagnosis of simple illnesses, and the use of Thai herbs instead of modern medicine by using principles of Thai traditional medication theory. These were disseminated by website network programs within Suan Sunandha Rajabhat University. The population used in this study was divided into two groups: the first group consisted of four experts of Thai traditional medication and the second group was 300 website users. The methods used for collecting data were paper questionnaires and poll questionnaires on the website. The statistics used for analyzing data was at an average level. The results were divided into three parts: the first part was the development of a knowledge-based system and the second part was applied programs on website. Both parts could be fulfilled and achieved according to the set goal. The third part was the evaluation of the study: The evaluation of the viewpoints of the experts towards website designs were evaluated at a good level of 4.20. The satisfaction evaluation of the users was found at a good level of average satisfactory level at 4.24. It was found that the young population of those under the age of 16 had less cares about their health than the population of other teenagers, working age adults and those of older age. The research findings should be extended in order to encourage the lifestyle modifications to people of all ages by using the self-healthcare principles.
Abstract: The linguistic competence of Thai university students majoring in Business English was examined in the context of knowledge of English language inflection, and also various linguistic elements. Errors analysis was applied to the results of the testing. Levels of errors in inflection, tense and linguistic elements were shown to be significantly high for all noun, verb and adjective inflections. Findings suggest that students do not gain linguistic competence in their use of English language inflection, because of interlanguage interference. Implications for curriculum reform and treatment of errors in the classroom are discussed.
Abstract: Regular exercise promotes reduction in blood pressure, reduction in body weight and it also helps to increase in insulin sensitivity. Participation in physical activity should always be linked to medical screening which can reveal serious medical problems. One of them is high blood pressure. Hypertension is risk factor for one billion people worldwide and the highest prevalence is found in Africa. Another component of hypertension is that people who suffer from hypertension have no symptoms. It is estimated that reduction of 3mm Hg in Systolic Blood Pressure decreases cardiac morbidity at least 5%. The most of the guidelines suggest aerobic exercise in a prevention of cardiovascular diseases. On the other hand, it is important to emphasize the impact of resistance training. Even, it was found higher effect for reduction on the level of systolic blood pressure than aerobic exercise.
Abstract: Local utilities often face problems of local industrial
wastes, storm water disposal due to existing strict regulations. For
many local industries, the problem of wastewater treatment and
discharge into surface reservoirs can’t be solved through the use of
conventional biological treatment techniques. Current discharge
standards require very strict removal of a number of impurities such
as ammonia, nitrates, phosphate, etc. To reach this level of removal,
expensive reagents and sorbents are used.
The modern concept of rational water resources management
requires the development of new efficient techniques that provide
wastewater treatment and reuse.
As RO membranes simultaneously reject all dissolved impurities
such as BOD, TDS, ammonia, phosphates etc., they become very
attractive for the direct treatment of wastewater without biological
stage. To treat wastewater, specially designed membrane "open
channel" modules are used that do not possess "dead areas" that cause
fouling or require pretreatment. A solution to RO concentrate
disposal problem is presented that consists of reducing of initial
wastewater volume by 100 times. Concentrate is withdrawn from
membrane unit as sludge moisture. The efficient use of membrane
RO techniques is connected with a salt balance in water system.
Thus, to provide high ecological efficiency of developed techniques,
all components of water supply and wastewater discharge systems
should be accounted for.
Abstract: In this study, the Mo-electrode thin films were deposited using two-stepped process and the high purity copper indium selenide-based powder (CuInSe2, CIS) was fabricated by using hydrothermal process by Nanowin Technology Co. Ltd. Because the CIS powder was aggregated into microscale particles, the CIS power was ground into nano-scale particles. 6 wt% CIS particles were mixed and dispersed into isopropyl alcohol (IPA). A new non-vacuum thin-film deposition process, spray coating method (SPM), was investigated to deposit the high-densified CIS absorber layers. 0.1 ml CIS solution was sprayed on the 20 mm×10 mm Mo/glass substrates and then the CuInSe2 thin films were annealed in a selenization furnace using N2 as atmosphere. The annealing temperature and time were set at 550oC and 5 min, and 0.0g~0.6g extra Se content was added in the furnace. The influences of extra Se content on the densification, crystallization, resistivity (ρ), hall mobility (μ), and carrier concentration of the CIS absorber layers were well investigated in this study.