Abstract: The purpose of this study was to investigate the relationships among leisure motivation, leisure attitude, and health promotion lifestyle. The participants were recruited from a convenience sampling that subjects were at least 55 years of age in Tainan City, Taiwan. Three hundred survey instruments were distributed, and 227 effective instruments were returned, for an effective rate of 75.7%. The collected data were analyzed statistically. The findings of this research were as follows: 1.There is significantly correlated between leisure motivation and leisure attitude. 2. There is significantly correlated between leisure attitude and health promotion lifestyle. 3. There is significantly correlated between leisure motivation and health promotion lifestyle.
Abstract: Water is a fundamental attraction in all cultures and among all classes of people,tourists and citizens. It is a favorite location for major tourism initiatives, celebrations and ceremonies. The vitality of any city depends on citizen action to take part in creating the neighborhoods they desire. Waterfront can provide extensive new areas of high quality public open space in parts of the city that are popular venues for social activities and also have the highest land values. Each city must have a character that can be used as a key attraction for the development. The morphology of a waterfront can be identified by both its physical characteristics and the socio-cultural activities that take place in the area. Alexandria has been selected as an area of study because it has a unique character due to its possession of a variety of waterfronts.
This paper aims to set some criteria of successful waterfront development and then through these criteria analyzing the development of the Qaitbay waterfront in the eastern harbor in Alexandria, Egypt. Hence, a comprehensive improvement of the waterfront areas is certainly needed to ensure a successful waterfront development radiated the sense of uniformity and coherence.
Alexandria can benefit from these criteria to develop its urban waterfront in order to preserve and revitalize its unique waterfront character and achieve mixed uses and tourism development.
Abstract: Polymer composite nano-fibers including (1, 3 wt %)
silver nano-particles have been produced by electrospinning method.
Polyacrylonitrile/N,N-dimethylformamide (PAN/DMF) solution have
been prepared and the amount of silver nitrate have been adjusted to
PAN weight. Silver nano-particles were obtained from reduction of
silver ions into silver nano-particles by chemical reduction by
hydrazine hydroxide (N2H5OH). The different amount of silver salt
was loaded into polymer matrix to obtain polyacrylonitrile composite
nano-fiber containing silver nano-particles. The effect of the amount
of silver nano-particles on the properties of composite nano-fiber web
was investigated. Electrical conductivity, mechanical properties,
thermal properties were examined by Microtest LCR Meter 6370
(0.01 mΩ-100 MΩ), Tensile tester, Differential scanning calorimeter
DSC (Q10) and SEM respectively. Also antimicrobial efficiency test
(ASTM E2149-10) was done against to Staphylococcus aureus
bacteria. It has been seen that breaking strength, conductivity,
antimicrobial effect, enthalpy during cyclization increase by use of
silver nano-particles while the diameter of nano-fiber decreases.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: In recent years, many researchers are involved in the
field of fuzzy theory. However, there are still a lot of issues to be
resolved. Especially on topics related to controller design such as the
field of robot, artificial intelligence, and nonlinear systems etc.
Besides fuzzy theory, algorithms in swarm intelligence are also a
popular field for the researchers. In this paper, a concept of utilizing
one of the swarm intelligence method, which is called Bacterial-GA
Foraging, to find the stabilized common P matrix for the fuzzy
controller system is proposed. An example is given in in the paper, as
well.
Abstract: In this paper, we present a neural-network (NN) based
approach to represent a nonlinear Tagagi-Sugeno (T-S) system. A
linear differential inclusion (LDI) state-space representation is utilized
to deal with the NN models. Taking advantage of the LDI
representation, the stability conditions and controller design are
derived for a class of nonlinear structural systems. Moreover, the
concept of utilizing the Parallel Particle Swarm Optimization (PPSO)
algorithm to solve the common P matrix under the stability criteria is
given in this paper.
Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Flanges are widely used for connecting valves, pipes and other industrial devices such as gearboxes. Method of producing a flange has a considerable impact on the manner of their involvement with the industrial engines and gearboxes. By Using die casting instead of sand casting and machining for manufacturing flanges, production speed and dimensional accuracy of the parts increases. Also, in die casting, obtained dimensions are close to final dimensions and hence the need for machining flanges after die casting process decreases which makes a significant savings in raw materials and improves the mechanical properties of flanges. In this paper, a typical die of an industrial helical gearbox flange (size ISO 50) was designed and die casting process for producing this type of flange was simulated using ProCAST software. The results of simulation were used for optimizing die design. Finally, using the results of the analysis, optimized die was built.
Abstract: Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.
Abstract: Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.
Abstract: Although several factors that affect learning to
program have been identified over the years, there continues to be no
indication of any consensus in understanding why some students learn
to program easily and quickly while others have difficulty. Seldom
have researchers considered the problem of how to help the students
enhance the programming learning outcome. The research had been
conducted at a high school in Taiwan. Students participating in the
study consist of 330 tenth grade students enrolled in the Basic
Computer Concepts course with the same instructor. Two types of
training methods-instruction-oriented and exploration-oriented were
conducted. The result of this research shows that the
instruction-oriented training method has better learning performance
than exploration-oriented training method.
Abstract: The Montreal protocol and Kyoto protocol underlined the need of substitution of CFC’s and HCFC’s due to their adverse impact on atmospheric ozone layer which protects earth from U.V rays. The CFCs have been entirely ruled out since 1995 and a long-term basis HCFCs must be replaced by 2020. All this events motivated HFC refrigerants which are harmless to ozone layer. In this paper thermodynamic analysis of cascade refrigeration system has been done using three different refrigerant pairs R13-R12, R290-R23, and R404A-R23. Effect of various operating parameters i.e. evaporator temperature, condenser temperature, temperature difference in cascade condenser and low temperature cycle condenser temperature on performance parameters viz. COP, exergetic efficiency and refrigerant mass flow ratio have been studied. Thermodynamic analysis shows that out of three refrigerant pairs R12-R13, R290-R23 and R404A-R23 the COP of R290-R23 refrigerant pair is highest.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: In this paper, a fifth order propagator operators are proposed for estimating the Angles Of Arrival (AOA) of narrowband electromagnetic waves impinging on antenna array when its number of sensors is larger than the number of radiating sources.
The array response matrix is partitioned into five linearly dependent phases to construct the noise projector using five different propagators from non diagonal blocks of the spectral matrice of the received data; hence, five different estimators are proposed to estimate the angles of the sources. The simulation results proved the performance of the proposed estimators in the presence of white noise comparatively to high resolution eigen based spectra.
Abstract: In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem. Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA).
Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.
Abstract: The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.