Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: In this paper, we present a neural-network (NN) based
approach to represent a nonlinear Tagagi-Sugeno (T-S) system. A
linear differential inclusion (LDI) state-space representation is utilized
to deal with the NN models. Taking advantage of the LDI
representation, the stability conditions and controller design are
derived for a class of nonlinear structural systems. Moreover, the
concept of utilizing the Parallel Particle Swarm Optimization (PPSO)
algorithm to solve the common P matrix under the stability criteria is
given in this paper.
Abstract: Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This paper is aimed to investigate farmers’ level of awareness and behavior of chemical pesticide uses, by using a case study of Suan Luang Sub- District Municipality, Ampawa, Samut Songkram Province. Questionnaire was employed in this study with the farmers from 46 households to explore their level of awareness in chemical pesticide uses, while interview and observation were adopted in exploring their behavior of chemical pesticide uses. The findings reflected the farmers’ high level of awareness in chemical pesticide uses in the hazardous effects of the chemical to human and environmental health, while their behavior of chemical pesticide uses explained their awareness paid to the right way of using pesticides, for instance reading the direction on the label, keeping children and animals away from the area of pesticide mixing, covering body with clothes and wearing hat and mask, no smoking, eating or drinking during pesticide spray or standing in windward direction.
Abstract: In recent years, geographic information systems (GIS)
and remote sensing using has increased to estimate runoff catchment.
In this research, runoff curve number maps for captive catchment of
Tehran by helping GIS and also remote sensing which based on
factors such as vegetation, lands using, group of soil hydrology and
hydrological conditions were obtained. Runoff curve numbers map
was obtained by combining these maps in ARC GIS and SCS table.
To evaluate the accuracy of the results, the maximum flow rate of
flood which was obtained from curve numbers, was compared with
the measured maximum flood rate at the watershed outlet and
correctness of curve numbers were approved.
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: In this paper the design, fabrication, and testing of a miniaturized rectangular microstrip patch antenna loaded with DNG metamaterials is reported. The metamaterial is composed of two nested spiral strips and a single straight strip which are etched on two sides of a 5.7 mm×5.7 mm Rogers RT/duroid 5880 with 0.5 mm thickness and dielectric constant of 2.2. Two units of this structure as a double negative (DNG) medium in combination with air as a double positive (DPS) medium are used as substrate of the microstrip patch antenna. By placing these metamaterial structures under the patch, a sub-wavelength resonance occurs which leads to a smaller size patch antenna compared to the conventional antenna at that frequency. The total size of the proposed antenna is reduced 54.6%. The dimensions of the proposed patch antenna are significantly smaller than the wavelength of the operation frequency with respect to the conventional patch antenna. Simulation result and test result for the proposed patch antenna are given and compared.
Abstract: This paper increases directivity and gain of Small Planar Dipole Antenna (SPDA) by using Symmetrical Pyramidal Block (SPB) which operates in X band at 11 GHz. The SPB consists four sides; each of which is metamaterial with Epsilon Negative Medium (ENG) and Epsilon Near-Zero (ENZ). The results simulated using the High Frequency Structure Simulator (HFSS) show that the SPB is capable of enhancing directivity and gain for the SPDA with maximum gain of 2.46 dB. The reflection coefficient is -13.7037 dB with narrow beam width.
Abstract: In this paper, an analytical study is made for the dynamic behavior of human brain tissue under transient loading. In this analytical model the Mooney-Rivlin constitutive law is coupled with visco-elastic constitutive equations to take into account both the nonlinear and time-dependent mechanical behavior of brain tissue. Five ordinary differential equations representing the relationships of five main parameters (radial stress, circumferential stress, radial strain, circumferential strain, and particle velocity) are obtained by using the characteristic method to transform five partial differential equations (two continuity equations, one motion equation, and two constitutive equations). Analytical expressions of the attenuation properties for spherical wave in brain tissue are analytically derived. Numerical results are obtained based on the five ordinary differential equations. The mechanical responses (particle velocity and stress) of brain are compared at different radii including 5, 6, 10, 15 and 25 mm under four different input conditions. The results illustrate that loading curves types of the particle velocity significantly influences the stress in brain tissue. The understanding of the influence by the input loading cures can be used to reduce the potentially injury to brain under head impact by designing protective structures to control the loading curves types.
Abstract: Small and medium-sized enterprises (SME) are the backbone of central Europe’s economies and have a significant contribution to the gross domestic product. Production planning and scheduling (PPS) is still a crucial element in manufacturing industries of the 21st century even though this area of research is more than a century old. The topic of PPS is well researched especially in the context of large enterprises in the manufacturing industry. However the implementation of PPS methodologies within SME is mostly unobserved. This work analyzes how PPS is implemented in SME with the geographical focus on Switzerland and its vicinity. Based on restricted resources compared to large enterprises, SME have to face different challenges. The real problem areas of selected enterprises in regards of PPS are identified and evaluated. For the identified real-life problem areas of SME clear and detailed recommendations are created, covering concepts and best practices and the efficient usage of PPS. Furthermore the economic and entrepreneurial value for companies is lined out and why the implementation of the introduced recommendations is advised.
Abstract: Experimental Film Class Project is supported by the Institute for Research and Development at Suan Sunandha Rajabhat University. This project is purported to provide academic and professional services to improve the quality standards of the community and locals in accordance with the mission of the university, which is to improve and expand knowledge for the community and to develop and transfer such knowledge and professions to the next generation. Eventually, it leads to sustainable development because the development of human resources is deemed as the key for sustainable development. Moreover, the Experimental Film Class is an integral part of the teaching of film production at Suan Sunandha International School of Art (SISA). By means of giving opportunities to students for participation in projects by sharing experience, skill and knowledge and participation in field activities, it helps students in the film production major to enhance their abilities and potentials as preparation for their readiness in the marketplace. Additionally, in this class, we provide basic film knowledge, screenwriting techniques, editing and subtitles including uploading videos on social media such as YouTube and Facebook for the participant students.
Abstract: This research’s objectives were to analyze the using of new media in the form of set up candid clip that affects the product and presenter, to study the effectiveness of using new media in the form of set up candid clip in order to increase the circulation and audience satisfaction and to use the earned information and knowledge to develop the communication for publicizing and advertising via new media. This research is qualitative research based on questionnaire from 50 random sampling representative samples and in-depth interview from experts in publicizing and advertising fields. The findings indicated the positive and negative effects to the brands’ image and presenters’ image of product named “Scotch 100” and “Snickers” that used set up candid clips via new media for publicizing and advertising in Thailand. It will be useful for fields of publicizing and advertising in the new media forms.
Abstract: This paper proposes a GLMM with spatial and
temporal effects for malaria data in Thailand. A Bayesian method is
used for parameter estimation via Gibbs sampling MCMC. A
conditional autoregressive (CAR) model is assumed to present the
spatial effects. The temporal correlation is presented through the
covariance matrix of the random effects. The malaria quarterly data
have been extracted from the Bureau of Epidemiology, Ministry of
Public Health of Thailand. The factors considered are rainfall and
temperature. The result shows that rainfall and temperature are
positively related to the malaria morbidity rate. The posterior means
of the estimated morbidity rates are used to construct the malaria
maps. The top 5 highest morbidity rates (per 100,000 population) are
in Trat (Q3, 111.70), Chiang Mai (Q3, 104.70), Narathiwat (Q4,
97.69), Chiang Mai (Q2, 88.51), and Chanthaburi (Q3, 86.82).
According to the DIC criterion, the proposed model has a better
performance than the GLMM with spatial effects but without
temporal terms.
Abstract: Negotiation is a specific form of interaction based on communication in which the parties enter into deliberately, each with clear but different interests or goals and a mutual dependency towards a decision due to be taken at the end of the confrontation. Consequently, negotiation is a complex activity involving many different disciplines from the strategic aspects and the decision making process to the evaluation of alternatives or outcomes and the exchange of information. While gender differences can be considered as one of the most researched topic within negotiation studies, empirical works and theory present many conflicting evidences and results about the role of gender in the process or the outcome. Furthermore, little interest has been shown over gender differences in the definition of what is negotiation, its essence or fundamental elements. Or, as differences exist in practices, it might be essential to study if the starting point of these discrepancies does not come from different considerations about what is negotiation and what will encourage the participants in their strategic decisions. Some recent and promising experiments made with diverse groups show that male and female participants in a common and shared situation barely consider the same way the concepts of power, trust or stakes which are largely considered as the usual driving forces of any negotiation. Furthermore, results from Human Resource self-assessment tests display and confirm considerable differences between individuals regarding essential behavioral dimensions like capacity to improvise and to achieve, aptitude to conciliate or to compete and orientation towards power and group domination which are also part of negotiation skills. Our intention in this paper is to confront these dimensions with negotiation’s usual driving forces in order to build up new paths for further research.
Abstract: This study was aimed to investigate the effect of
various organic supplements on growth and development of
Dendrobium discolor’s protocorms and seedlings growth of
Dendrobium Judy Rutz. Protocorms of Dendrobium discolor with 2.0
cm. in diameter and seedlings of Dendrobium Judy Rutz at the same
size (0.5 cm. height) were sub-cultured on Hyponex medium
supplemented with cow milk (CM), soy milk (SM), potato extract
(PE) and peptone (P) for 2 months. The protocorms were developed
to seedlings in all treatments after cultured for 2 months. However,
the best results were found on Hyponex medium supplemented with
P was the best in which the maximum fresh and dry weight and
maximum shoot height were obtained in this treatment statistically
different (p ≤ 0.05) to other treatments. Moreover, Hyponex medium
supplemented with P also stimulated the maximum mean number of
5.7 shoots per explant which also showed statistically different (p ≤
0.05) when compared to other treatments. The results of growth of
Dendrobium Judy Rutz seedlings indicated the medium
supplemented with 100 mL/L PE enhanced the maximum fresh and
dry weigh per explants with significantly different (p ≤ 0.05) in fresh
weight from other treatments including the control medium without
any organic supplementation. However, the dry weight was not
significantly different (p ≤ 0.05) from medium supplemented with
SM and P. There was multiple shoots induction in all media with or
without organic supplementation ranging from 2.6 to 3 shoots per
explants. The maximum shoot height was also obtained in the
seedlings cultured on medium supplemented with PE while the
longest root length was found in medium supplemented with SM.
Abstract: This study aimed to investigate effect of different organic supplements on growth of Vanda and Mokara seedlings. Vanda and Mokara seedlings approximately 0.2 and 0.3 cm. in height were sub-cultured onto VW supplemented with 150 ml/L coconut water, 100 g/L potato extract, 100 g/L ‘Gros Michel’ banana (AAA group) and 100 g/L ‘Namwa’ banana (ABB group). The explants were sub-cultured onto the same medium every month for 3 months. The best medium increased stem height to 0.52 and 0.44 Cm. in Vanda and Mokara respectively was supplemented with coconut water. The maximum fresh weight of Vanda (0.59 g) was found on medium supplemented with ‘Gros Michel’ banana while Mokara cultured on medium supplemented with Potato extract had the maximum fresh weight (0.27 g) and number of roots (5.20 roots/shoot) statistically different (p≤ 0.05) to other treatments. However, Vanda cultured on medium supplemented with ‘Namwa’ banana had the maximum number of roots (3.80 roots/shoot). Our results suggested that growth of different orchid genera was responded diversely to different organic supplements.
Abstract: Use of plants grown in local area for edible has a long tradition in different culture. The indigenous knowledge such as usage of plants as vegetables by local people is risk to disappear when no records are done. In order to conserve and transfer this valuable heritage to the new generation, ethnobotanical study should be investigated and documented. The survey of vegetable plants traditionally used was carried out in the year 2012. Information was accumulated via questionnaires and oral interviewing from 100 people living in 36 villages of 9 districts in Amphoe Huai Mek, Kalasin, Thailand. Local plant names, utilized parts and preparation methods of the plants were recorded. Each mentioned plant species were collected and voucher specimens were prepared. A total of 55 vegetable plant species belonging to 34 families and 54 genera were identified. The plant habits were tree, shrub, herb, climber, and shrubby fern at 21.82%, 18.18%, 38.18%, 20.00% and 1.82% respectively. The most encountered vegetable plant families were Leguminosae (20%), Cucurbitaceae (7.27%), Apiaceae (5.45%), whereas families with 3.64% uses were Araceae, Bignoniaceae, Lamiaceae, Passifloraceae, Piperaceae and Solanaceae. The most common consumptions were fresh or brief boiled young shoot or young leaf as side dishes of ‘jaeo, laab, namprik, pon’ or curries. Most locally known vegetables included 45% of the studied plants which grow along road side, backyard garden, hedgerow, open forest and rice field.
Abstract: Modelling and simulation provide effective way to
acquire engineering experience. An active approach to modelling and
simulation proposed in the paper involves, beside the compulsory
part directed by the traditional step-by-step instructions, the new
optional part basing on the human’s habits to design thus stimulating
the efforts towards success in active learning. Computer exercises as
a part of engineering curriculum incorporate a set of effective
activities. In addition to the knowledge acquired in theoretical
training, the described educational arrangement helps to develop
problem solutions, computation skills, and experimentation
performance along with enhancement of practical experience and
qualification.
Abstract: Gypsum is being applied to ameliorate subsoil acidity and to overcome the problem of very slow lime movement from surface lime applications. Reduced Crude Conversion Spent Lime (RCCSL) containing anhydrite was evaluated for use as a liming material with specific consideration given to the movement of sulfate into the acid subsoil. Agricultural lime and RCCSL were applied at 0, 0.5, 1.0, and 1.5 times the lime requirement of 6.72 Mg ha-1 to an acid Trappist silt loam (TypicHapuldult). Corn [Zea mays (L.)]was grown following lime material application and soybean [Glycine max (L.) Merr.]was grown in the second year.Soil pH increased rapidly with the addition of the RCCSL material. Over time there was no difference in soil pH between the materials but there was with increasing rate. None of the observed changes in plant nutrient concentration had an impact on yield. Grain yield was higher for the RCCSL amended treatments in the first year but not in the second. There was a significant increase in soybean grain yield from the full lime requirement treatments over no lime.