Abstract: This study presents the numerical simulation of three-dimensional incompressible steady and laminar fluid flow and conjugate heat transfer of a trapezoidal microchannel heat sink using water as a cooling fluid in a silicon substrate. Navier-Stokes equations with conjugate energy equation are discretized by finite-volume method. We perform numerical computations for a range of 50 ≦ Re ≦ 600, 0.05W ≦ P ≦ 0.8W, 20W/cm2 ≦q"≦ 40W/cm2. The present study demonstrates the numerical optimization of a trapezoidal microchannel heat sink design using the response surface methodology (RSM) and the genetic algorithm method (GA). The results show that the average Nusselt number increases with an increase in the Reynolds number or pumping power, and the thermal resistance decreases as the pumping power increases. The thermal resistance of a trapezoidal microchannel is minimized for a constant heat flux and constant pumping power.
Abstract: Solid lipid nanoparticles (SLNs) have gained great attention for the topical treatment of skin associated fungal infection as they facilitate the skin penetration of loaded drugs. Our work deals with the preparation of nystatin loaded solid lipid nanoparticles (NystSLNs) using the hot homogenization and ultrasonication method. The prepared NystSLNs were characterized in terms of entrapment efficiency, particle size, zeta potential, transmission electron microscopy, differential scanning calorimetry, rheological behavior and in vitro drug release. A stability study for 6 months was performed. A microbiological study was conducted in male rats infected with Candida albicans, by counting the colonies and examining the histopathological changes induced on the skin of infected rats. The results showed that SLNs dispersions are spherical in shape with particle size ranging from 83.26±11.33 to 955.04±1.09 nm. The entrapment efficiencies are ranging from 19.73±1.21 to 72.46±0.66% with zeta potential ranging from -18.9 to -38.8 mV and shear-thinning rheological Behavior. The stability studies done for 6 months showed that nystatin (Nyst) is a good candidate for topical SLN formulations. A least number of colony forming unit/ ml (cfu/ml) was recorded for the selected NystSLN compared to the drug solution and the commercial Nystatin® cream present in the market. It can be fulfilled from this work that SLNs provide a good skin targeting effect and may represent promising carrier for topical delivery of Nyst offering the sustained release and maintaining the localized effect, resulting in an effective treatment of cutaneous fungal infection.
Abstract: In this paper, the design of a coaxial feed single layer rectangular microstrip patch antenna for three different wireless communication band applications is presented. The proposed antenna is designed by using substrate Roger RT/duroid 5880 having permittivity of about 2.2 and tangent loss of 0.0009. The characteristics of the substrate are designed and to evaluate the performance of modeled antenna using HFSS v.11 EM simulator, from Ansoft. The proposed antenna has small in size and operates at 2.25GHz, 3.76GHz and 5.23GHz suitable for mobile satellite service (MSS) network, WiMAX and WLAN applications. The dimension of the patch and slots are optimized to obtain these desired functional frequency ranges. The simulation results with frequency response, radiation pattern and return loss, VSWR, Input Impedance are presented with appropriate table and graph.
Abstract: Generally, distributed generation units refer to small-scale electric power generators that produce electricity at a site close to the customer or an electric distribution system (in parallel mode). From the customers’ point of view, a potentially lower cost, higher service reliability, high power quality, increased energy efficiency, and energy independence can be the key points of a proper DG unit. Moreover, the use of renewable types of distributed generations such as wind, photovoltaic, geothermal or hydroelectric power can also provide significant environmental benefits. Therefore, it is of crucial importance to study their impacts on the distribution networks. A marked increase in Distributed Generation (DG), associated with medium voltage distribution networks, may be expected. Nowadays, distribution networks are planned for unidirectional power flows that are peculiar to passive systems, and voltage control is carried out exclusively by varying the tap position of the HV/MV transformer. This paper will compare different DG control methods and possible network reconfiguration aimed at assessing their effect on voltage profiles.
Abstract: Time base maintenance (TBM) is conventionally applied by the power utilities to maintain circuit breakers (CBs), transformers, bus bars and cables, which may result in under maintenance or over maintenance. As information and communication technology (ICT) industry develops, the maintenance policies of many power utilities have gradually changed from TBM to condition base maintenance (CBM) to improve system operating efficiency, operation cost and power supply reliability. This paper discusses the feasibility of using intelligent electronic devices (IEDs) to construct a CB CBM management platform. CBs in power substations can be monitored using IEDs with additional logic configuration and wire connections. The CB monitoring data can be sent through intranet to a control center and be analyzed and integrated by the Elipse Power Studio software. Finally, a human-machine interface (HMI) of supervisory control and data acquisition (SCADA) system can be designed to construct a CBM management platform to provide maintenance decision information for the maintenance personnel, management personnel and CB manufacturers.
Abstract: This paper is concerned with minimization of mean
tardiness and flow time in a real single machine production
scheduling problem. Two variants of genetic algorithm as metaheuristic
are combined with hyper-heuristic approach are proposed to
solve this problem. These methods are used to solve instances
generated with real world data from a company. Encouraging results
are reported.
Abstract: As an emerging business model, cloud computing has been initiated to satisfy the need of organizations and to push Information Technology as a utility. The shift to the cloud has changed the way Information Technology departments are managed traditionally and has raised many concerns for both, public and private sectors.
The purpose of this study is to investigate the possibility of cloud computing services replacing services provided traditionally by IT departments. Therefore, it aims to 1) explore whether organizations in Oman are ready to move to the cloud; 2) identify the deciding factors leading to the adoption or rejection of cloud computing services in Oman; and 3) provide two case studies, one for a successful Cloud provider and another for a successful adopter.
This paper is based on multiple research methods including conducting a set of interviews with cloud service providers and current cloud users in Oman; and collecting data using questionnaires from experts in the field and potential users of cloud services.
Despite the limitation of bandwidth capacity and Internet coverage offered in Oman that create a challenge in adopting the cloud, it was found that many information technology professionals are encouraged to move to the cloud while few are resistant to change.
The recent launch of a new Omani cloud service provider and the entrance of other international cloud service providers in the Omani market make this research extremely valuable as it aims to provide real-life experience as well as two case studies on the successful provision of cloud services and the successful adoption of these services.
Abstract: Wireless communications have been expanded very fast in recent decades. This technology relies on an extensive network of base stations and antennas, using radio frequency signals to transmit information. Devices that use wireless communication, while offering various services, basically act as sources of non-ionizing electromagnetic fields (EMF). Such devices are permanently present in human vicinity and almost constantly radiate, causing EMF pollution of the environment. This fact has initiated development of modern systems for observation of the EMF pollution, as well as for risk assessment. This paper presents the Serbian electromagnetic field monitoring network – SEMONT, designed for automated, remote and continuous broadband monitoring of EMF in the environment. Measurement results of the SEMONT monitoring at one of the test locations, within the main campus of the University of Novi Sad, are presented and discussed, along with corresponding exposure assessment of the general population, regarding the Serbian legislation.
Abstract: Intrabody communication (IBC) is a new way of transferring data using human body as a medium. Minute current can travel though human body without any harm. IBC can remove electrical wires for human area network. IBC can be also a secure communication network system unlike wireless networks which can be accessed by anyone with bad intentions. One of the IBC systems is based on frequency shift keying modulation where individual data are transmitted to the external devices for the purpose of secure access such as digital door lock. It was found that the quality of IBC data transmission was heavily dependent on ground configurations of electronic circuits. Reliable IBC transmissions were not possible when both of the transmitter and receiver used batteries as circuit power source. Transmission was reliable when power supplies were used as power source for both transmitting and receiving sites because the common ground was established through the grounds of instruments such as power supply and oscilloscope. This was due to transmission dipole size and the ground effects of floor and AC power line. If one site used battery as power source and the other site used the AC power as circuit power source, transmission was possible.
Abstract: In this paper, we present a neural-network (NN) based
approach to represent a nonlinear Tagagi-Sugeno (T-S) system. A
linear differential inclusion (LDI) state-space representation is utilized
to deal with the NN models. Taking advantage of the LDI
representation, the stability conditions and controller design are
derived for a class of nonlinear structural systems. Moreover, the
concept of utilizing the Parallel Particle Swarm Optimization (PPSO)
algorithm to solve the common P matrix under the stability criteria is
given in this paper.
Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: In this paper, a fifth order propagator operators are proposed for estimating the Angles Of Arrival (AOA) of narrowband electromagnetic waves impinging on antenna array when its number of sensors is larger than the number of radiating sources.
The array response matrix is partitioned into five linearly dependent phases to construct the noise projector using five different propagators from non diagonal blocks of the spectral matrice of the received data; hence, five different estimators are proposed to estimate the angles of the sources. The simulation results proved the performance of the proposed estimators in the presence of white noise comparatively to high resolution eigen based spectra.
Abstract: This paper deals with the problem of delay-dependent
stability for neural networks with distributed delays. Some new
sufficient condition are derived by constructing a novel
Lyapunov-Krasovskii functional approach. The criteria are
formulated in terms of a set of linear matrix inequalities, this is
convenient for numerically checking the system stability using the
powerful MATLAB LMI Toolbox. Moreover, in order to show the
stability condition in this paper gives much less conservative results
than those in the literature, numerical examples are considered.
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: Social media refers to the means of interactions
among people in which they create share, exchange and comment
contents among themselves in virtual communities and networks.
Social media or "social networking" has almost become part of our
daily lives and being tossed around over the past few years. It is like
any other media such as newspaper, radio and television but it is far
more than just about sharing information and ideas. Social
networking tools like Twitter, Facebook, Flickr and Blogs have
facilitated creation and exchange of ideas so quickly and widely than
the conventional media. This paper shows the choices,
communication, feeling comfort, time saving and effects of social
media among the people.
Abstract: Object detection using Wavelet Neural Network (WNN) plays a major contribution in the analysis of image processing. Existing cluster-based algorithm for co-saliency object detection performs the work on the multiple images. The co-saliency detection results are not desirable to handle the multi scale image objects in WNN. Existing Super Resolution (SR) scheme for landmark images identifies the corresponding regions in the images and reduces the mismatching rate. But the Structure-aware matching criterion is not paying attention to detect multiple regions in SR images and fail to enhance the result percentage of object detection. To detect the objects in the high-resolution remote sensing images, Tagged Grid Matching (TGM) technique is proposed in this paper. TGM technique consists of the three main components such as object determination, object searching and object verification in WNN. Initially, object determination in TGM technique specifies the position and size of objects in the current image. The specification of the position and size using the hierarchical grid easily determines the multiple objects. Second component, object searching in TGM technique is carried out using the cross-point searching. The cross out searching point of the objects is selected to faster the searching process and reduces the detection time. Final component performs the object verification process in TGM technique for identifying (i.e.,) detecting the dissimilarity of objects in the current frame. The verification process matches the search result grid points with the stored grid points to easily detect the objects using the Gabor wavelet Transform. The implementation of TGM technique offers a significant improvement on the multi-object detection rate, processing time, precision factor and detection accuracy level.
Abstract: With the increasing popularity of the Internet, online reading has become an essential source for EFL readers. Using strategies to comprehend information on online reading texts play a crucial role in students’ academic success. Metacognitive reading strategies are effective factors that enhance EFL learners reading comprehension. This study aimed at exploring the use of online metacognitive reading strategies by postgraduate Libyan EFL students. Quantitative data was collected using the Survey of Online Reading Strategies (OSORS). The findings revealed that the participants were moderate users of metacognitive online reading strategies. Problem solving strategies were the most frequently reported used strategies, while support reading strategies were the least. The five most and least frequently reported strategies were identified. Based on the findings, some future research recommendations were presented.
Abstract: Traditional Wireless Sensor Networks (WSNs) generally use static sinks to collect data from the sensor nodes via multiple forwarding. Therefore, network suffers with some problems like long message relay time, bottle neck problem which reduces the performance of the network.
Many approaches have been proposed to prevent this problem with the help of mobile sink to collect the data from the sensor nodes, but these approaches still suffer from the buffer overflow problem due to limited memory size of sensor nodes. This paper proposes an energy efficient scheme for data gathering which overcomes the buffer overflow problem. The proposed scheme creates virtual grid structure of heterogeneous nodes. Scheme has been designed for sensor nodes having variable sensing rate. Every node finds out its buffer overflow time and on the basis of this cluster heads are elected. A controlled traversing approach is used by the proposed scheme in order to transmit data to sink. The effectiveness of the proposed scheme is verified by simulation.
Abstract: In the last few years, harmonics have been occurred
with the increasing use of nonlinear loads, and these harmonics have
been an ever increasing problem for the line systems. This situation
importantly affects the quality of power and gives large losses to the
network. An efficient way to solve these problems is providing
harmonic compensation through parallel active power filters. Many
methods can be used in the control systems of the parallel active
power filters which provide the compensation. These methods
efficiently affect the performance of the active power filters. For this
reason, the chosen control method is significant. In this study, Fourier
analysis (FA) control method and synchronous reference frame (SRF)
control method are discussed. These control methods are designed for
both eliminate harmonics and perform reactive power compensation
in MATLAB/Simulink pack program and are tested. The results have
been compared for each two methods.