Abstract: Decision making is a vital part of the business world
and any other field of human endeavor. Which way a business
organization will take, and where that way will lead it, depends on
broad range of decisions made by managers in the managerial
structure. Strategic decisions are of the greatest importance for
organizational success. Although much empirical research has been
done trying to describe and explain its nature and effectiveness,
knowledge about strategic decision making is still incomplete. This
paper explores the nature of strategic decision making in particular
setting - in Croatian companies. The main focus of this research is on
the style that decision makers on strategic management level are
following when making decisions of life importance for their
companies. Two main decision making style that explain the way
decision maker collects and processes available information and
performs all the activities in strategic decision making process were
empirical tested: rational and intuitive one. Besides analyzing their
existence on strategic management level in Croatian companies, their
effectiveness is analyzed as well. Results showed that decision
makers at strategic management level are following both styles
somewhat equally in order to function effectively, and that intuitive
style is more effective when considering decisions outcomes.
Abstract: Service Oriented Architecture (SOA) allows modeling of dynamic interaction between incongruous providers, which enables governing the development of complex applications. However, implementation of SOA comes with some challenges, including its adaptability and robustness. Dynamism is inherent to the nature of service based applications and of their running environment. These factors lead to necessity for dynamic adaptation. In this paper we try to describe basics and main structure of SOA adaptation process with a conceptual view to this issue. In this survey we will review the relevant adaptation approaches. This paper allows studying how different approaches deal with service oriented architecture adaptation life-cycle and provides basic guidelines for their analysis, evaluation and comparison.
Abstract: Metal matrix composites (MMCs) have gained a
considerable interest in the last three decades. Conventional powder
metallurgy production route often involves the addition of reinforcing
phases into the metal matrix directly, which leads to poor wetting
behavior between ceramic phase and metal matrix and the
segregation of reinforcements. The commonly used elements for
ceramic phase formation in iron based MMCs are Ti, Nb, Mo, W, V
and C, B. The aim of the present paper is to investigate the effect of
sintering temperature and V-B addition on densification, phase
development, microstructure, and hardness of Fe–V-B composites
(Fe-(5-10) wt. %B – 25 wt. %V alloys) prepared by powder
metallurgy process. Metal powder mixes were pressed uniaxial and
sintered at different temperatures (ranging from 1300 to 1400ºC) for
1h. The microstructure of the (V, B) Fe composites was studied with
the help of high magnification optical microscope and XRD.
Experimental results show that (V, B) Fe composites can be produced
by conventional powder metallurgy route.
Abstract: Vertical slotted walls can be used as permeable
breakwaters to provide economical and environmental protection
from undesirable waves and currents inside the port. The permeable
breakwaters are partially protection and have been suggested to
overcome the environmental disadvantages of fully protection
breakwaters. For regular waves a semi-analytical model is based on
an eigenfunction expansion method and utilizes a boundary condition
at the surface of each wall are developed to detect the energy
dissipation through the slots. Extensive laboratory tests are carried
out to validate the semi-analytic models. The structure of the physical
model contains two walls and it consists of impermeable upper and
lower part, where the draft is based a decimal multiple of the total
depth. The middle part is permeable with a porosity of 50%. The
second barrier is located at a distant of 0.5, 1, 1.5 and 2 times of the
water depth from the first one. A comparison of the theoretical results
with previous studies and experimental measurements of the present
study show a good agreement and that, the semi-analytical model is
able to adequately reproduce most the important features of the
experiment.
Abstract: The study explored the role of metacognition in foreign language anxiety on a sample of 411 Taiwanese students of English as a Foreign Language. The reading strategy inventory was employed to evaluate the tertiary learners’ level of metacognitive awareness and a semi-structured background questionnaire was also used to examine the learners’ perceptions of their English proficiency and satisfaction of their current English learning. In addition, gender and academic level differences in employment of reading strategies were investigated. The results showed the frequency of reading strategy use increase slightly along with academic years and males and females actually employ different reading strategies. The EFL tertiary learners in the present study utilized cognitive strategies more frequently than metacognitive strategies or support strategies. Male students use metacognitive strategy more often while female students use cognitive and support strategy more frequently.
Abstract: Each of the countries around the world has different
ways of management and many of them depend on people to
administrate their country. Thailand, for example, empowers the
sovereignty of Thai people under constitution; however, our Thai
voting system is not able to flow fast enough under the current
Political management system. The sovereignty of Thai people is
addressing this problem through representatives during current
elections, in order to set a new policy for the countries ideology to
change in the House and the Cabinet.
This is particularly important in a democracy to be developed
under our current political institution. The Organic Act on Political
Parties 2007 is the establishment we have today that is causing
confrontations within the establishment. There are many political
parties that will soon be abolished. Many political parties have
already been subsidized. This research study is to analyze the legal
problems with the political party establishment under the Organic Act
on Political Parties 2007.
This will focus on the freedom of each political establishment
compared to an effective political operation. Textbooks and academic
papers will be referenced from studies home and abroad.
The study revealed that Organic Act on Political Parties 2007 has
strict provisions on the political structure over the number of
members and the number of branches involved within political
parties system.
Such operations shall be completed within one year; but under the
existing laws the small parties are not able to participate with the
bigger parties. The cities are capable of fulfilling small political party
requirements but fail to become coalesced because the current laws
won't allow them to be united as one. It is important to allow all
independent political parties to join our current political structure.
Board members can’t help the smaller parties to become a large
organization under the existing Thai laws.
Creating a new establishment that functions efficiently throughout
all branches would be one solution to these legal problems between
all political parties. With this new operation, individual political
parties can participate with the bigger parties during elections. Until
current political institutions change their system to accommodate
public opinion, these current Thai laws will continue to be a problem
with all political parties in Thailand.
Abstract: Microwave dielectric ceramic materials of
(Mg1-xNix)2(Ti0.95Sn0.05)O4 for x = 0.01, 0.03, 0.05, 0.07 and 0.09 were
prepared and sintered at 1250–1400 ºC. The microstructure and
microwave dielectric properties of the ceramic materials were
examined and measured. The observations shows that the content of
Ni2+ ions has little effect on the crystal structure, dielectric constant,
temperature coefficient of resonant frequency (τf) and sintering
temperatures of the ceramics. However, the quality values (Q×f) are
greatly improved due to the addition of Ni2+ ions. The present study
showed that the ceramic material prepared for x = 0.05 and sintered at
1325ºC had the best Q×f value of 392,000 GHz, about 23%
improvement compared with that of Mg2(Ti0.95Sn0.05)O4.
Abstract: Tsunami early detection and warning systems have proved to be of ultimate importance, especially after the destructive tsunami that hit Japan in March 2012. Such systems are crucial to inform the authorities of any risk of a tsunami and of the degree of its danger in order to make the right decision and notify the public of the actions they need to take to save their lives. The purpose of this research is to enhance existing tsunami detection and warning systems. We first propose an automated and miniaturized model of an early tsunami detection and warning system. The model for the operation of a tsunami warning system is simulated using the data acquisition toolbox of Matlab and measurements acquired from specified internet pages due to the lack of the required real-life sensors, both seismic and hydrologic, and building a graphical user interface for the system. In the second phase of this work, we implement various satellite image filtering schemes to enhance the acquired synthetic aperture radar images of the tsunami affected region that are masked by speckle noise. This enables us to conduct a post-tsunami damage extent study and calculate the percentage damage. We conclude by proposing improvements to the existing telecommunication infrastructure of existing warning tsunami systems using a migration to IP-based networks and fiber optics links.
Abstract: The analysis and design of thin shell structures is a topic of interest in a variety of engineering applications. In structural mechanics problems the analyst seeks to determine the distribution of stresses throughout the structure to be designed. It is also necessary to calculate the displacements of certain points of the structure to ensure that specified allowable values are not exceeded. In this paper a comparative study between displacement and strain based finite elements applied to the analysis of some thin shell structures is presented. The results obtained from some examples show the efficiency and the performance of the strain based approach compared to the well known displacement formulation.
Abstract: The impact deformation and fracture behaviour of cobalt-based Haynes 188 superalloy are investigated by means of a split Hopkinson pressure bar. Impact tests are performed at strain rates ranging from 1×103 s-1 to 5×103 s-1 and temperatures between 25°C and 800°C. The experimental results indicate that the flow response and fracture characteristics of cobalt-based Haynes 188 superalloy are significantly dependent on the strain rate and temperature. The flow stress, work hardening rate and strain rate sensitivity all increase with increasing strain rate or decreasing temperature. It is shown that the impact response of the Haynes 188 specimens is adequately described by the Zerilli-Armstrong fcc model. The fracture analysis results indicate that the Haynes 188 specimens fail predominantly as the result of intensive localised shearing. Furthermore, it is shown that the flow localisation effect leads to the formation of adiabatic shear bands. The fracture surfaces of the deformed Haynes 188 specimens are characterised by dimple- and / or cleavage-like structure with knobby features. The knobby features are thought to be the result of a rise in the local temperature to a value greater than the melting point.
Abstract: Sustainable urban waterfront development is one of the
most interesting phenomena of urban renewal in the last decades.
However, there are still many cities whose visual image is
compromised due to the lack of a sustainable urban waterfront
development, which consequently affects the place of those cities
globally. This paper aims to reimagine the role of waterfront areas in
city design, with a particular focus on Egypt, so that they provide
attractive, sustainable urban environments while promoting the
continued aesthetic development of the city overall. This aim will be
achieved by determining the main principles of a sustainable urban
waterfront and its applications. This paper concentrates on
sustainability assessment rating systems. A number of international
case-studies, wherein a city has applied the basic principles for a
sustainable urban waterfront and have made use of sustainability
assessment rating systems, have been selected as examples which can
be applied to the urban waterfronts in Egypt. This paper establishes the
importance of developing the design of urban environments in Egypt,
as well as identifying the methods of sustainability application for
urban waterfronts.
Abstract: The present study is an analysis of the forced convection heat transfer in porous channel with an oriented jet at the inlet with uniform velocity and temperature distributions. The upper wall is insulated when the bottom one is kept at constant temperature higher than that of the fluid at the entrance. The dynamic field is analysed by the Brinkman-Forchheimer extended Darcy model and the thermal field is traduced by the energy one equation model. The numerical solution of the governing equations is obtained by using the finite volume method. The results mainly concern the effect of Reynolds number, jet angle and thermal conductivity ratio on the flow structure and local and average Nusselt numbers evolutions.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.
Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: CNFET has emerged as an alternative material to
silicon for high performance, high stability and low power SRAM
design in recent years. SRAM functions as cache memory in
computers and many portable devices. In this paper, a new SRAM
cell design based on CNFET technology is proposed. The proposed
SRAM cell design for CNFET is compared with SRAM cell designs
implemented with the conventional CMOS and FinFET in terms of
speed, power consumption, stability, and leakage current. The
HSPICE simulation and analysis show that the dynamic power
consumption of the proposed 8T CNFET SRAM cell’s is reduced
about 48% and the SNM is widened up to 56% compared to the
conventional CMOS SRAM structure at the expense of 2% leakage
power and 3% write delay increase.