Abstract: A simple, rapid and non-invasive electromagnetic sensor (C-FAST device) was- patented; for diagnosis of HCV RNA. Aim: To test the validity of the device compared to standard HCV PCR. Subjects and Methods: The first phase was done as pilot in Egypt on 79 participants; the second phase was done in five centers: one center from Egypt, two centers from Pakistan and two centers from India (800, 92 and 113 subjects respectively). The third phase was done nationally as multicenter study on (1600) participants for ensuring its representativeness. Results: When compared to PCR technique, C-FAST device revealed sensitivity 95% to 100%, specificity 95.5% to 100%, PPV 89.5% to 100%, NPV 95% to 100% and positive likelihood ratios 21.8% to 38.5%. Conclusion: It is practical evidence that HCV nucleotides emit electromagnetic signals that can be used for its identification. As compared to PCR, C-FAST is an accurate, valid and non-invasive device.
Abstract: Information in the nervous system is coded as firing patterns of electrical signals called action potential or spike so an essential step in analysis of neural mechanism is detection of action potentials embedded in the neural data. There are several methods proposed in the literature for such a purpose. In this paper a novel method based on empirical mode decomposition (EMD) has been developed. EMD is a decomposition method that extracts oscillations with different frequency range in a waveform. The method is adaptive and no a-priori knowledge about data or parameter adjusting is needed in it. The results for simulated data indicate that proposed method is comparable with wavelet based methods for spike detection. For neural signals with signal-to-noise ratio near 3 proposed methods is capable to detect more than 95% of action potentials accurately.
Abstract: PPARs function as regulators of lipid and lipoprotein metabolism. The aim of the study was to compare the lipid profile between two phases of fasting and to examine the frequency and relationship of peroxisome proliferator-activated receptor, PPARα gene polymorphisms to lipid profile in fasting respondents. We conducted a case-control study protocol, which included 21 healthy volunteers without gender discrimination at the age of 18 years old. 3 ml of blood sample was drawn before the fasting phase and during the fasting phase (in Ramadhan month). 1ml of serum for the lipid profile was analyzed by using the automated chemistry analyser (Olympus, AU 400) and the data were analysed using the Paired T-Test (SPSS ver.20). DNA was extracted and PCR was conducted utilising 6 sets of primer. Primers were designed within 6 exons of interest in PPARα gene. Genetic and metabolic characteristics of fasting respondents and controls were estimated and compared. Fasting respondents were significantly have lowered the LDL levels (p=0.03). There were no polymorphisms detected except in exon 1 with 5% of this population study respectively. The polymorphisms in exon 1 of the PPARα gene were found in low frequency. Regarding the 1375G/T and 1386G/T polymorphisms in the exon 1 of the PPARα gene, the T-allele in fasting phase had no association with the decreased LDL levels (Fisher Exact Test). However this association is more promising when the sample size is larger in order to elucidate the precise impact of the polymorphisms on lipid profile in the population. In conclusion, the PPARα gene polymorphisms do not appear to affect the LDL of fasting respondents.
Abstract: Since nickel is a known toxic and carcinogenic metal, the present study was designed to evaluate the level of nickel released into the saliva of orthodontic patients. Non-stimulated saliva was collected from 18 patients attending The Orthodontic Clinic of Dental Faculty of Benghazi University. Patients were divided into two groups and level of nickel was determined by atomic absorption spectrophotometry. Nickel concentration value (mg/L) in first group prior to starting treatment was 0.097± 0.071. An increase in level of nickel was followed by decrease 4 and 8 weeks after applying the arch wire (0.208± 0.112) and (0.077±0.056 mg/L) respectively. Nickel levels in saliva of the second group were showed minimal variation and ranged from 0.061± 0.044mg/L to 0.083±0.054 throughout period of study. It may be concluded that there could be a release of nickel from the appliances used in first group but it doesn't reach toxic level in saliva.
Abstract: This study was conducted to examine the possible role of serum Gamma-glutamyltransferase (GGT) and Lactate dehydrogenase (LDH) in the prediction of severity of preeclampsia. The study group comprised of 40 preeclamptic cases (22 with mild and 18 with severe) and 40 healthy normotensive pregnant controls. Serum samples of all the cases were assayed for GGT and LDH. Demographic, hemodynamic and laboratory data as well as serum GGT and LDH levels were compared among the three groups.
The results indicated that severe preeclamptic cases had significantly increased levels of serum GGT and LDH. The symptoms in severe preeclamptic women were significantly increased in patients with GGT > 70 IU/L and LDH >800 IU/L. Elevated levels of serum GGT and LDH can be used as biochemical markers which reflects the severity of preeclampsia and useful for the management of preeclampsia to decrease maternal and fetal morbidity and mortality.
Abstract: This study aims to examine the application of
occupational health and safety supervision in Turkey and EU
countries in terms of legal regulations. The results of research reveal
that occupational health and safety supervision in EU countries,
whatever the understanding of welfare state, is effectively carried out
and almost all legal regulations on this subject are consistent with the
EU directives. On the other hand, there are serious problems in
applications, not legal regulations, of occupational health and safety
supervision in Turkey by the side of EU countries. Indeed, Turkey
has modern regulations on occupational health and safety supervision
whereas there are several problems such as ignoring prevention
policy on occupational health and safety supervision, understanding
of monotype inspector, problems resulting from this understanding
and dispersed structure of occupational health and safety
organizations in workplaces. As a result, Turkey needs to carry out
effective supervision mechanisms.
Abstract: A cross-sectional survey to ascertain the capacity of laboratory persons in using ICTs was conducted in 15 Ugandan districts (July-August 2013). A self-administered questionnaire served as data collection tool, interview guide and observation checklist. 69 questionnaires were filled, 12 interviews conducted, 45 HC observed. SPSS statistics 17.0 and SAS 9.2 software were used for entry and analyses. 69.35% of participants find it difficult to access a computer at work. Of the 30.65% who find it easy to access a computer at work, a significant 21.05% spend 0 hours on a computer daily. 60% of the participants cannot access internet at work. Of the 40% who have internet at work, a significant 20% lack email address but 20% weekly read emails weekly and 48% daily. It is viable/feasible to pilot informatics projects as strategies to build bridges develop skills for e-health landscape in laboratory services with a bigger financial muscle.
Abstract: In order to improve the overall safety of chemotherapy, safety-protecting netwas established for the whole process from prescribing by physicians, transcribing by nurses, dispensing by pharmacists to administering by nurses. The information system was used to check and monitorwhole process of administration and related sheets were computerized to simplify the paperwork.
Abstract: Mastitis is one of the most economic disease affecting dairy cows worldwide. Its classic diagnosis using bacterial culture and biochemical findings is a difficult and prolonged method. In this research, using of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) permitted identification of different microorganisms with high accuracy and rapidity (only 24 hours for microbial growth and analysis). During the application of MALDI-TOF MS, one hundred twenty strains of Staphylococcus and Streptococcus species isolated from milk of cows affected by clinical and subclinical mastitis were identified, and the results were compared with those obtained by traditional methods as API and VITEK 2 Systems. 37 of totality 39 strains (~95%) of Staphylococcus aureus (S. aureus) were exactly detected by MALDI TOF MS and then confirmed by a nuc-based PCR technique, whereas accurate identification was observed in 100% (50 isolates) of the coagulase negative staphylococci (CNS) and Streptococcus agalactiae (31 isolates). In brief, our results demonstrated that MALDI-TOF MS is a fast and truthful technique which has the capability to replace conventional identification of several bacterial strains usually isolated in clinical laboratories of microbiology.
Abstract: This paper presents views on condom use and the contexts of safe and unsafe sexual practices with different sexual partners and their relationships among Injecting Drug Users (IDUs) in Hai Phong, Vietnam. Fifteen IDUs participated and two local interviewers conducted qualitative semi-structured face-to-face interviews in September-October, 2012 in Vietnamese language. Data were analyzed thematically. Non-protective condom attitudes include negotiate or convince Female Sex Workers (FSW); not realizing risk, importance or necessity; partner doesn’t like, and having extra money/drug from clients. On the other hand, self-awareness, family-consciousness, suspicion of STI presence, fear of getting HIV, and client negotiation sometimes resulted in a safe-sex practice. A thematic diagram was developed to present the relationship (strong/weak) between condom attitude and sexual practice (safe/unsafe) by partner types. The experiences and views reflected in the qualitative information emphasize the heightened need for safe-sex education especially among young IDUs (male/female) highlighting sexual transmission risk.
Abstract: It was expected to benefit patient with hemiparesis after stroke by extensive arm rehabilitation, to partially regain forearm and hand function. This paper propose a robotic rehabilitation arm in assisting the hemiparetic patient to learn new ways of using and moving their weak arms. In this study, the robotic arm was driven by a somatosensory stimulated brain computer interface (BCI), which is a new modality BCI. The use of somatosensory stimulation is not only an input for BCI, but also a electrical stimulation for treatment of hemiparesis to strengthen the arm and improve its range of motion. A trial of this robotic rehabilitation arm was performed in a stroke patient with pure motor hemiparesis. The initial trial showed a promising result from the patient with great motivation and function improvement. It suggests that robotic rehabilitation arm driven by somatosensory BCI can enhance the rehabilitation performance and progress for hemiparetic patients after stroke.
Abstract: Cognitive symptoms and behavioral symptoms may, in fact, overlap and be related to the level of the general cognitive function. We have measured the behavioral aspects of autism and its correlation to the cognitive ability in 30 children with ASD. We used a neuropsychological Battery CANTAB eclipse to evaluate the ASD children's cognitive ability. Individuals with ASD and challenging behaviors showed significant correlation between some cognitive abilities and Motor aspects. Based on these findings, we can conclude that the motor behavioral problems in autism affect specific cognitive abilities in ASDs such as comprehension, learning, reversal, acquisition, attention set shifting, and speed of reaction to one stimulus. Future researches should also focus on the relationship between motor stereotypes and other subtypes of repetitive behaviors, such as verbal stereotypes, ritual routine adherence, and the use of different types of CANTAB tests.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: Purpose: This E-survey was carried out to facilitate the implementation and Education of VMAT (Volumetric Modulated Arc Therapy) in Radiotherapy-RT departments and reasons for not using IMRT (Intensity Modulated Radiotherapy). VMAT Skills in demand were also identified. Method: E-Survey was distributed to NHS hospitals across UK by email. Thirty NHS and related centres in England, 21 in Scotland, 3 in Ireland and 1 in Wales were contacted. This Survey was intended for those working in RT and Medical Physics and who were responsible for Treatment Planning and training. Results: This E-survey have indicated pathways adopted by staff to acquire VMAT skills, strategies to efficiently implement VMAT in RT departments and for obtaining VMAT Education. Conclusion: Despite poor survey response this survey has managed to highlight requirements for education and implementation of VMAT that are also applicable to IMRT. Other RT centres in world can also find these results useful.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Background: The high prevalence of obesity in Egypt has a great impact on the health care system, economic and social situation. Evidence suggests that even a moderate amount of weight loss can be useful. Aim of the study: To analyze the effects of lower body positive pressure supported treadmill training, conducted with hypocaloric diet, on body composition of obese children. Methods: Thirty children aged between 8 and 14 years, were randomly assigned into two groups: intervention group (15 children) and control group (15 children). All of them were evaluated using body composition analysis through bioelectric impedance. The following parameters were measured before and after the intervention: body mass, body fat mass, muscle mass, body mass index (BMI), percentage of body fat and basal metabolic rate (BMR). The study group exercised with antigravity treadmill three times a week during 2 months, and participated in a hypocaloric diet program. The control group participated in a hypocaloric diet program only. Results: Both groups showed significant reduction in body mass, body fat mass and BMI. Only study group showed significant reduction in percentage of body fat (p = 0.0.043). Changes in muscle mass and BMR didn't reach statistical significance in both groups. No significant differences were observed between groups except for muscle mass (p = 0.049) and BMR (p = 0.042) favoring study group. Conclusion: Both programs proved effective in the reduction of obesity indicators, but lower body positive pressure supported treadmill training was more effective in improving muscle mass and BMR.
Abstract: We present a dedicated video-based monitoring
system for quantification of patient’s attention to visual feedback
during robot assisted gait rehabilitation. Two different approaches for
eye gaze and head pose tracking are tested and compared. Several
metrics for assessment of patient’s attention are also presented.
Experimental results with healthy volunteers demonstrate that
unobtrusive video-based gaze tracking during the robot-assisted gait
rehabilitation is possible and is sufficiently robust for quantification
of patient’s attention and assessment of compliance with the
rehabilitation therapy.
Abstract: The article is proposing a base plan for the future Patient Care Information Systems in a changing health care environment where it is necessary to assure quality patient care services and reducing cost and where new technology trends give the opportunities to develop clinical applications and services patient focused according to new business objectives.
Abstract: The following case study presents the management of
stage III Differentiated Thyroid Cancer (DTC) patient in an NHS
hospital in London, UK during period of 2004-2005.
Abstract: Male factor infertility due to endocrine disturbances
such as abnormalities in prolactin levels are encountered in a
significant proportion. This case control study was carried out to
determine the effects of prolactin on the male reproductive tract,
using 200 male white rats. The rats were maintained as the control
group (G1), hypoprolactinaemic group (G2), 3 hyperprolactinaemic
groups induced using oral largactil (G3), low dose fluphenazine (G4)
and high dose fluphenazine (G5). After 100 days, rats were subjected
to serum prolactin (PRL) level measurements and for basic seminal
fluid analysis (BSA). The difference between serum PRL
concentrations of rats in G2, G3, G4 and G5 as compared to the
control group were highly significant by Student’s t-test (p