Abstract: A continuous time model of the interaction between
crop insect pests and naturally beneficial pest enemies is created
using a set of simultaneous, non-linear, ordinary differential
equations incorporating natural death rates based on the Weibull
distribution. The crop pest is present in all its life-cycle stages of:
egg, larva, pupa and adult. The beneficial insects, parasitoid wasps,
may be present in either or all parasitized: eggs, larva and pupa.
Population modelling is used to estimate the quantity of the natural
pest enemies that should be introduced into the pest infested
environment to suppress the pest population density to an
economically acceptable level within a prescribed number of days.
The results obtained illustrate the effect of different combinations of
parasitoid wasps, using the Pascal distribution to estimate their
success in parasitizing different pest developmental stages, to deliver
pest control to a sustainable level. Effective control, within a
prescribed number of days, is established by the deployment of two
or all three species of wasps, which partially destroy pest: egg, larvae
and pupae stages. The selected scenarios demonstrate effective
sustainable control of the pest in less than thirty days.
Abstract: High resolution seismic reflection has recently been carried out on Zaria batholith, with the aim of characterizing the granitic Zaria batholiths in terms of its lithology. The geology of the area has revealed that the older granite outcrops in the vicinity of Zaria are exposures of a syntectonics to late-tectonic granite batholiths which intruded a crystalline gneissic basement during the Pan-African Orogeny. During the data acquisition the geophone were placed at interval of 1 m, variable offset of 1 and 10 m was used. The common midpoint (CMP) method with 12 fold coverage was employed for the survey. Analysis of the generated 3D surface of the p wave velocities from different profiles for densities and bulk modulus revealed that the rock material is more consolidated in South East part of the batholith and less consolidated in the North Western part. This was in conformity with earlier identified geology of the area, with the South Eastern part majorly of granitic outcrop, while the North Western part is characterized with the exposure of gneisses and thick overburden cover. The difference in lithology was also confirmed by the difference in seismic sections and Arial satellite photograph. Hence two major lithologies were identified, the granitic and gneisses complex which are characterized by gradational boundaries.
Abstract: The effects of varying air temperature (full, ¾ full, ½ full aircon adjustment, no aircon) in polishing component of Single-Pass Mill on the quality of Philippine inbred rice variety, was investigated. Parameters measured were milling recovery (MR), headrice recovery (HR), and percentage with bran streaks. Cooling method (with aircon) increased MR, HR, and percentage with bran streaks of milled rice. Highest MR and HR (67.62%; 47.33%) were obtained from ¾ full adjustment whereas no aircon were lowest (66.27%; 39.76%). Temperature in polishing component at ¾ full adjustment was 33oC whereas no aircon was 45oC. There was increase of 1.35% in MR and 7.57% in HR. Additional cost of milling per kg due to aircon cooling was P0.04 at 300 tons/yr volume, with 0.15 yr payback period. Net income was estimated at ₱98,100.00. Percentage of kernels with bran streaks increased from 5%–14%, indicating more nutrients of milled rice.
Abstract: This paper is concerned with minimization of mean
tardiness and flow time in a real single machine production
scheduling problem. Two variants of genetic algorithm as metaheuristic
are combined with hyper-heuristic approach are proposed to
solve this problem. These methods are used to solve instances
generated with real world data from a company. Encouraging results
are reported.
Abstract: In recent years, many researchers are involved in the
field of fuzzy theory. However, there are still a lot of issues to be
resolved. Especially on topics related to controller design such as the
field of robot, artificial intelligence, and nonlinear systems etc.
Besides fuzzy theory, algorithms in swarm intelligence are also a
popular field for the researchers. In this paper, a concept of utilizing
one of the swarm intelligence method, which is called Bacterial-GA
Foraging, to find the stabilized common P matrix for the fuzzy
controller system is proposed. An example is given in in the paper, as
well.
Abstract: In this paper, we present a neural-network (NN) based
approach to represent a nonlinear Tagagi-Sugeno (T-S) system. A
linear differential inclusion (LDI) state-space representation is utilized
to deal with the NN models. Taking advantage of the LDI
representation, the stability conditions and controller design are
derived for a class of nonlinear structural systems. Moreover, the
concept of utilizing the Parallel Particle Swarm Optimization (PPSO)
algorithm to solve the common P matrix under the stability criteria is
given in this paper.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: The design of an optimised horizontal axis 5-meter-long wind turbine rotor blade in according with IEC 61400-2 standard is a research and development project in order to fulfil the requirements of high efficiency of torque from wind production and to optimise the structural components to the lightest and strongest way possible. For this purpose, a research study is presented here by focusing on the structural characteristics of a composite wind turbine blade via finite element modelling and analysis tools. In this work, first, the required data regarding the general geometrical parts are gathered. Then, the airfoil geometries are created at various sections along the span of the blade by using CATIA software to obtain the two surfaces, namely; the suction and the pressure side of the blade in which there is a hat shaped fibre reinforced plastic spar beam, so-called chassis starting at 0.5m from the root of the blade and extends up to 4 m and filled with a foam core. The root part connecting the blade to the main rotor differential metallic hub having twelve hollow threaded studs is then modelled. The materials are assigned as two different types of glass fabrics, polymeric foam core material and the steel-balsa wood combination for the root connection parts. The glass fabrics are applied using hand wet lay-up lamination with epoxy resin as METYX L600E10C-0, is the unidirectional continuous fibres and METYX XL800E10F having a tri-axial architecture with fibres in the 0,+45,-45 degree orientations in a ratio of 2:1:1. Divinycell H45 is used as the polymeric foam. The finite element modelling of the blade is performed via MSC PATRAN software with various meshes created on each structural part considering shell type for all surface geometries, and lumped mass were added to simulate extra adhesive locations. For the static analysis, the boundary conditions are assigned as fixed at the root through aforementioned bolts, where for dynamic analysis both fixed-free and free-free boundary conditions are made. By also taking the mesh independency into account, MSC NASTRAN is used as a solver for both analyses. The static analysis aims the tip deflection of the blade under its own weight and the dynamic analysis comprises normal mode dynamic analysis performed in order to obtain the natural frequencies and corresponding mode shapes focusing the first five in and out-of-plane bending and the torsional modes of the blade. The analyses results of this study are then used as a benchmark prior to modal testing, where the experiments over the produced wind turbine rotor blade has approved the analytical calculations.
Abstract: This paper presents the effect of electric field
distribution which is an electric field intensity analysis. Consideration
of the dielectric heating of grains and insects, the rice and rice
weevils are utilized for dielectric heating analysis. Furthermore, this
analysis compares the effect of electric field distribution in rice and
rice weevil. In this simulation, two copper plates are used to generate
the electric field for dielectric heating system and put the rice
materials between the copper plates. The simulation is classified in
two cases, which are case I one rice weevil is placed in the rice and
case II two rice weevils are placed at different position in the rice.
Moreover, the probes are located in various different positions on
plate. The power feeding on this plate is optimized by using CST EM
studio program of 1000 watt electrical power at 39 MHz resonance
frequency. The results of two cases are indicated that the most
electric field distribution and intensity are occurred on the rice and
rice weevils at the near point of the probes. Moreover, the heat is
directed to the rice weevils more than the rice. When the temperature
of rice and rice weevils are calculated and compared, the rice weevils
has the temperature more than rice is about 41.62 Celsius degrees.
These results can be applied for the dielectric heating applications to
eliminate insect.
Abstract: The dry-storage systems of nuclear power plants (NPPs) in Taiwan have become one of the major safety concerns. There are two steps considered in this study. The first step is the verification of the TRACE by using VSC-17 experimental data. The results of TRACE were similar to the VSC-17 data. It indicates that TRACE has the respectable accuracy in the simulation and analysis of the dry-storage systems. The next step is the application of TRACE in the dry-storage system of Kuosheng NPP (BWR/6). Kuosheng NPP is the second BWR NPP of Taiwan Power Company. In order to solve the storage of the spent fuels, Taiwan Power Company developed the new dry-storage system for Kuosheng NPP. In this step, the dry-storage system model of Kuosheng NPP was established by TRACE. Then, the steady state simulation of this model was performed and the results of TRACE were compared with the Kuosheng NPP data. Finally, this model was used to perform the safety analysis of Kuosheng NPP dry-storage system. Besides, FRAPTRAN was used tocalculate the transient performance of fuel rods.
Abstract: This paper presents the use of phasor bond graphs to
obtain the steady-state behavior of a synchronous generator. The
phasor bond graph elements are built using 2D multibonds, which
represent the real and imaginary part of the phasor. The dynamic
bond graph model of a salient-pole synchronous generator is showed,
and verified viz. a sudden short-circuit test. The reduction of the
dynamic model into a phasor representation is described. The
previous test is executed on the phasor bond graph model, and its
steady-state values are compared with the dynamic response. Besides,
the widely used power (torque)-angle curves are obtained by means
of the phasor bond graph model, to test the usefulness of this model.
Abstract: This paper proposes a phasor representation of
electrical networks by using bond graph methodology. A so-called
phasor bond graph is built up by means of two-dimensional bonds,
which represent the complex plane. Impedances or admittances are
used instead of the standard bond graph elements. A procedure to
obtain the steady-state values from a phasor bond graph model is
presented. Besides the presentation of a phasor bond graph library in
SIDOPS code, also an application example is discussed.
Abstract: This paper proposes a new method to find the equations
of transformation matrix for the rotation angles of the two rotational
axes and the coordinates of the three linear axes of an orthogonal
multi-axis milling machine. This approach provides intuitive physical
meanings for rotation angles of multi-axis machines, which can be
used to evaluate the accuracy of the conversion from CL data to NC
data.
Abstract: Historically, actuators’ redundancy was used to deal
with faults occurring suddenly in flight systems. This technique was
generally expensive, time consuming and involves increased weight
and space in the system. Therefore, nowadays, the on-line fault
diagnosis of actuators and accommodation plays a major role in the
design of avionic systems. These approaches, known as Fault
Tolerant Flight Control systems (FTFCs) are able to adapt to such
sudden faults while keeping avionics systems lighter and less
expensive. In this paper, a (FTFC) system based on the Geometric
Approach and a Reconfigurable Flight Control (RFC) are presented.
The Geometric approach is used for cosmic ray fault reconstruction,
while Sliding Mode Control (SMC) based on Lyapunov stability
theory is designed for the reconfiguration of the controller in order to
compensate the fault effect. Matlab®/Simulink® simulations are
performed to illustrate the effectiveness and robustness of the
proposed flight control system against actuators’ faulty signal caused
by cosmic rays. The results demonstrate the successful real-time
implementation of the proposed FTFC system on a non-linear 6 DOF
aircraft model.
Abstract: This study examined the predictive effects of moral competence, prosocial norms and positive behavior recognition on school misbehavior among Chinese junior secondary school students. Results of multiple regression analysis showed that students were more likely to misbehave in school when they had lower levels of moral competence and prosocial norms, and when they perceived their positive behavior being less likely recognized. Practical implications were discussed on how to guide students to make the right choices to behave appropriately in school. Implications for future research were also discussed.
Abstract: In this paper, the stability analysis of a GA-Based adaptive fuzzy sliding model controller for a nonlinear system is discussed. First, a nonlinear plant is well-approximated and described with a reference model and a fuzzy model, both involving FLC rules. Then, FLC rules and the consequent parameter are decided on via an Evolved Bat Algorithm (EBA). After this, we guarantee a new tracking performance inequality for the control system. The tracking problem is characterized to solve an eigenvalue problem (EVP). Next, an adaptive fuzzy sliding model controller (AFSMC) is proposed to stabilize the system so as to achieve good control performance. Lyapunov’s direct method can be used to ensure the stability of the nonlinear system. It is shown that the stability analysis can reduce nonlinear systems into a linear matrix inequality (LMI) problem. Finally, a numerical simulation is provided to demonstrate the control methodology.
Abstract: This paper presents a nonparametric method to obtain the hazard rate “Bathtub curve” for power system components. The model is a mixture of the three known phases of a component life, the decreasing failure rate (DFR), the constant failure rate (CFR) and the increasing failure rate (IFR) represented by three parametric Weibull models. The parameters are obtained from a simultaneous fitting process of the model to the Kernel nonparametric hazard rate curve. From the Weibull parameters and failure rate curves the useful lifetime and the characteristic lifetime were defined. To demonstrate the model the historic time-to-failure of distribution transformers were used as an example. The resulted “Bathtub curve” shows the failure rate for the equipment lifetime which can be applied in economic and replacement decision models.
Abstract: Packaging for vanadium redox flow battery is one of the key elements for successful implementation of flow battery in the electrical energy storage system. Usually the bulky battery size and low energy densities make this technology not available for mobility application. ThereforeRFB with improved packaging size and energy capacity are highly desirable. This paper focuses on the study of packaging improvement for unit cell V-RFB to the application on Series Hybrid Electric Vehicle. Two different designs of 25cm2 and 100cm2 unit cell V-RFB at same current density are used for the sample in this investigation. Further suggestions on packaging improvement are highlighted.
Abstract: The objective is to identify the contributions from the introduction of the computerized system deal within the Accounting Department of Brazilian Navy Financial Directorship and its possible effects on the budgetary and financial harvest of Brazilian Navy. The relevance lies in the fact that the management process is responsible for the continuous improvement of organizational performance through higher levels of quality in their activities. Improvements in organizational processes have direct effects on crops cost, quality, reliability, flexibility and speed. The method of study of this research is the case study. The choice of case study attended, among other demands, a need for greater flexibility to study processes related to a computerized system. The sources of evidence were used literature, documentary and direct observation. Direct observation was made by monitoring the implementation of the computerized system in the Division of Management Analysis. The main findings of the study point to the fact that the computerized system may contribute significantly to the standardization of information. There was improvement of internal processes in the division of management analysis, made possible the consolidation of a standard management and performance analysis that contribute to global homogeneity in the treatment of information essential to the process of decision making. This study has limitations related to the fact the search result be subject exclusively to the case studied, and it is impossible to generalize to other organs of government.