Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The inhibition of SH2 domain regulated protein-protein interactions is an attractive target for developing an effective chemotherapeutic approach in the treatment of disease. Molecular simulation is a useful tool for developing new drugs and for studying molecular recognition. In this study, we searched potential drug compounds for the inhibition of SH2 domain by performing structural similarity search in PubChem Compound Database. A total of 37 compounds were screened from the database, and then we used the LibDock docking program to evaluate the inhibition effect. The best three compounds (AP22408, CID 71463546 and CID 9917321) were chosen for MD simulations after the LibDock docking. Our results show that the compound CID 9917321 can produce a more stable protein-ligand complex compared to other two currently known inhibitors of Src SH2 domain. The compound CID 9917321 may be useful for the inhibition of SH2 domain based on these computational results. Subsequently experiments are needed to verify the effect of compound CID 9917321 on the SH2 domain in the future studies.
Abstract: New diagnostic tools are urgently needed to interrupt the transmission of tuberculosis and multidrug-resistant tuberculosis. The microscopic-observation drug-susceptibility (MODS) assay is a rapid, accurate and simple liquid culture method to detect multidrug-resistant tuberculosis (MDR-TB). MODS were evaluated to determine a lower and same concentration of isoniazid and rifampin for detection of MDR-TB. Direct drug-susceptibility testing was performed with the use of the MODS assay. Drug-sensitive control strains were tested daily. The drug concentrations that used for both isoniazid and rifampin were at the same concentration: 0.16, 0.08 and 0.04μg per milliliter. We tested 56 M. tuberculosis clinical isolates and the control strains M. tuberculosis H37RV. All concentration showed same result. Of 53 M. tuberculosis clinical isolates, 14 were MDR-TB, 38 were susceptible with isoniazid and rifampin, 1 was resistant with isoniazid only. Drug-susceptibility testing was performed with the use of the proportion method using Mycobacteria Growth Indicator Tube (MGIT) system as reference. The result of MODS assay using lower concentration was significance (P
Abstract: The purpose of this paper is to focus on security and safety issues facing by pharmaceutical industry globally when counterfeit drugs are in question. Hence, there is an intense need to secure and authenticate pharmaceutical products in the emerging counterfeit product market. This paper will elaborate the application of radio frequency identification (RFID) in pharmaceutical industry and to identify its key benefits for patient’s care. The benefits are: help to co-ordinate the stream of supplies, accuracy in chains of supplies, maintaining trustworthy information, to manage the operations in appropriate and timely manners and finally deliver the genuine drug to patient. It is discussed that how RFID supported supply chain information sharing (SCIS) helps to combat against counterfeit drugs. And a solution how to tag pharmaceutical products; since, some products prevent RFID implementation in this industry. In this paper, a proposed model for pharma industry distribution suggested to combat against the counterfeit drugs when they are in supply chain.
Abstract: Malaria constitutes one of the major health problems
in Nigeria. One of the reasons attributed for the upsurge was the
development of resistance of Plasmodium falciparum and the
emergence of multi-resistant strains of the parasite to anti-malaria
drugs. A continued search for other effective, safe and cheap plantbased
anti-malaria agents thus becomes imperative in the face of
these difficulties. The objective of this study is therefore to evaluate
the in vivo anti-malarial efficacy of ethanolic extracts of
Chromolaena odorata and Androgaphis paniculata leaves. The two
plants were evaluated for their anti-malaria efficacy in vivo in a 4-day
curative test assay against Plasmodium berghei strain in mice. The
group treated with 500mg/ml dose of ethanolic extract of A.
paniculata plant showed parasite suppression with increase in Packed
Cell Volume (PCV) value except day 3 which showed a slight
decrease in PCV value. During the 4-day curative test, an increase in
the PCV values, weight measurement and zero count of Plasmodium
berghei parasite values was recorded after day 3 of drug
administration. These results obtained in group treated with A.
paniculata extract showed anti-malarial efficacy with higher
mortality rate in parasitaemia count when compared with
Chromolaena odorata group. These results justify the use of
ethanolic extracts of A. paniculata plant as medicinal herb used in
folklore medicine in the treatment of malaria.
Abstract: The use of herbs to treat disease is accompanied with the history of human life. This research is aimed to study the anti-inflammatory and antinociceptive effects of hydroalcoholic extract of aerial parts of "Tanacetum balsamita balsamita". In the experimental studies 144 male mice are used. In the inflammatory test, animals were divided into six groups: Control, positive control (receiving Dexamethason at dose of 15mg/kg), and four experimental groups receiving Tanacetum balsamita balsamita hydroalcoholic extract at doses of 25, 50, 100 and 200mg/kg. Xylene was used to induce inflammation. Formalin was used to study the nociceptive effects. Animals were divided into six groups: control group, positive control group (receiving morphine) and four experimental groups receiving Tanacetum balsamita balsamita (Tb.) hydroalcoholic extract at doses of 25, 50, 100 and 200mg/kg. I.p. injection of drugs or normal saline was performed 30 minutes before test. The data were analyzed by using one way Variance analysis and Tukey post test. Aerial parts of Tanacetum balsamita balsamita hydroalcoholic extract decreased significantly inflammatory at dose of 200mg/kg (P
Abstract: Diabetes is a chronic metabolic disorder that affects the quality of life in terms of physical health, social and psychological well-being. In spite of the enormous progress in the treatment of diabetes using existing commercial drugs, such as, insulin and oral hypoglycemic agents, the quest and search for new drugs is imperative due to several limitations of the commercial drugs. In addition, the existing diabetic drugs are expensive and unaffordable by the rural populace in the developing countries. The present study demonstrates the anti-diabetic property of aqueous extract of Bryophyllum pinnatum (BP) leaves using diabetic rats (albino rats) as models. At the same time, the anti-diabetic effect of the aqueous extract was compared to that of a sample containing a mixture of the extract and a commercial diabetic medicine, glibenclamide. A specified dosage of aqueous extract of Bryophyllum pinnatum (BP) leaves was administered on the experimental diabetic rats, and their BGL was measured and recorded. The results showed a significant drop in the BGL of the diabetic rats to a value close to normal blood glucose level within 120 minutes when only aqueous extract from BP leaves was used. When a sample containing a mixture of the aqueous extract and glibenclamide was administered, a further drop in BGL was observed. Therefore, the results reveal that aqueous extract of Bryophyllum pinnatum leaves have significant anti-diabetic properties, and that the performance of the existing drugs (glibenclamide) could be enhanced with the use of the aqueous extract.
Abstract: Fluoroquinolones are a group of antibiotics widely used because of their broad spectrum activity against both Gram-positive and Gram-negative bacteria. In this study, ciprofloxacin and levofloxacin were administered to rats at therapeutic doses to evaluate their effects on plasma arylesterase activity, as well as, on hepatic advanced oxidized protein products (AOPPs) and malondialdehyde (MDA) levels, as measures of oxidative stress. Ciprofloxacin (80 mg/kg body weight) and levofloxacin (40 mg/kg body weight) were administered to male albino rats for 7 and 14 days. The data obtained demonstrated that plasma arylesterase activity was significantly decreased by both drugs with ciprofloxacin administration inhibiting the activity by 29% and 30% while Levofloxacin treatment resulted in 35% and 30% inhibition, after 7 and 14 days treatment respectively. Hepatic AOPP and MDA levels were both elevated by these antibiotics. This study supplies further evidence that fluoroquinolones at therapeutic doses promote oxidative stress.
Abstract: Pyrazinamide (PZA) is among the first-line pro-drugs in the tuberculosis (TB) combination chemotherapy used to treat Mycobacterium tuberculosis. Numerous reports have suggested that hepatotoxicity due to pyrazinamide in patients is due to inappropriate dosing. It is, therefore necessary to develop sensitive and reliable techniques for determining the PZA metabolic profile of diagnosed patients promptly and at point-of-care. This study reports the determination of PZA based on nanobiosensor systems developed from disuccinimidyl octanedioate modified Cytochrome P450-2E1 (CYP2E1) electrodeposited on gold substrates derivatised with (poly(8-anilino-1-napthalene sulphonic acid) PANSA/PVP-AgNPs nanocomposites. The rapid and sensitive amperometric PZA detection gave a dynamic linear range of 2µM to 16µM revealing a
limit of detection of 0.044µM and a sensitivity of 1.38µA/µM. The Michaelis-Menten parameters; KM, KM app and IMAX were calculated to be 6.0µM, 1.41µM and 1.51x10-6 A, respectively, indicating a nanobiosensor suitable for use in serum.
Abstract: The import value of Antimicrobial drugs reached approximately fifteen million Baht in 2010, considered as the highest import value of all modern drugs, and this value is rising every year. Antimicrobials are considered the hazardous drugs by the Ministry of Public Health (No. 10). This research was conducted in order to investigate the past knowledge of drug use and Antimicrobial drug use behavior. A total of 757 students were selected as the samples out of a population of 1,800 students. This selected students had the experience of Antimicrobial drugs use a year ago. A questionnaire was utilized in this research. The findings put on the view that knowledge gained by the students about proper use of Antimicrobials drugs was not brought into practice. This suggests that the education procedure regarding drug use needs adjustment. And therefore the findings of this research are expected to be utilized as guidelines for educating people about the proper use of Antimicrobials drugs. At a broader perspective, correct drug use behavior of the public may potentially reduce drug cost of the Ministry of Public Health of Thailand.
Abstract: The paper presents a new drugs delivery system, based on the thin film technology. As a model antitumor drug, highly toxic doxorubicin is chosen. The system is based on the technology of obtaining zinc oxide composite of doxorubicin by deposition of nanosize ZnO films on the surface of doxorubicin coating on glass substrate using DC magnetron sputtering of zinc targets in Ar:O2 medium at room temperature. For doxorubicin zinc oxide compositions in the form of coatings and gels with 180-200nm thick ZnO films, higher (by a factor 2) in vivo (ascitic Ehrlich's carcinoma) antitumor activity is observed at low doses of doxorubicin in comparison with that of the initial preparation at therapeutic doses. The vector character of the doxorubicin zinc oxide composite transport to tumor tissues ensures the increase in antitumor activity as well as decrease of toxicity in comparison with the initial drug.
Abstract: In Pharmaceutical industries, it is very important to remove drug residues from the equipment and areas used. The cleaning procedure must be validated, so special attention must be devoted to the methods used for analysis of trace amounts of drugs. A rapid, sensitive and specific reverse phase ultra performance liquid chromatographic (UPLC) method was developed for the quantitative determination of Albendazole in cleaning validation swab samples. The method was validated using an ACQUITY HSS C18, 50 x 2.1mm, 1.8μ column with a isocratic mobile phase containing a mixture of 1.36g of Potassium dihydrogenphosphate in 1000mL MilliQ water, 2mL of triethylamine and pH adjusted to 2.3 ± 0.05 with ortho-phosphoric acid, Acetonitrile and Methanol (50:40:10 v/v). The flow rate of the mobile phase was 0.5 mL min-1 with a column temperature of 350C and detection wavelength at 254nm using PDA detector. The injection volume was 2µl. Cotton swabs, moisten with acetonitrile were used to remove any residue of drug from stainless steel, teflon, rubber and silicon plates which mimic the production equipment surface and the mean extraction-recovery was found to be 91.8. The selected chromatographic condition was found to effectively elute Albendazole with retention time of 0.67min. The proposed method was found to be linear over the range of 0.2 to 150µg/mL and correlation coefficient obtained is 0.9992. The proposed method was found to be accurate, precise, reproducible and specific and it can also be used for routine quality control analysis of these drugs in biological samples either alone or in combined pharmaceutical dosage forms.
Abstract: Supersaturation of drugs in the gastrointestinal tract is one approach to increase the absorption of poorly water-soluble drugs. The stabilization of a supersaturated state was achieved by adding precipitation inhibitors that may act through a variety of mechanisms. In this study, the effect of the natural gums, acacia, gelatin, pectin and tragacanth on curcumin supersaturation in simulated gastric fluid (SGF) (pH 1.2), fasted state simulated gastric fluid (FaSSGF) (pH 1.6), and simulated intestinal fluid (SIF) (pH 6.8) was investigated. The results indicated that all natural gums significantly increased the curcumin solubility (about 1.2-6-fold) when compared to the absence of gum, and assisted in maintaining the supersaturated drug solution. Among the tested gums, pectin at 3% w/w was the best precipitation inhibitor with a significant increase in the degree of supersaturation about 3-fold in SGF, 2.4-fold in FaSSGF and 2-fold in SIF.
Abstract: Oil entrapped floating alginate beads of curcumin were developed and characterized. Cremophor EL, Cremophor RH and Tween 80 were utilized to improve the solubility of the drug. The oil-loaded floating gel beads prepared by emulsion gelation method contained sodium alginate, mineral oil and surfactant. The drug content and % encapsulation declined as the ratio of surfactant was increased. The release of curcumin from 1% alginate beads was significantly more than for the 2% alginate beads. The drug released from the beads containing 25% of Tween 80 was about 70% while a higher drug release was observed with the beads containing Cremophor EL or Cremohor RH (approximately 90%). The developed floating beads of curcumin powder with surfactant provided a superior drug release than those without surfactant. Floating beads based on oil entrapment containing the drug solubilized in surfactants is a new delivery system to enhance the dissolution of poorly soluble drugs.
Abstract: In this project we are interested in studying different kinds of shed snake skins in order to apply them as a model membrane for pharmaceutical purposes instead of human stratum corneum. Many types of shed snake skins as well as model drugs were studied by different techniques. The data will give deeper understanding about the interaction between drugs and model membranes and may allow us to choose the suitable model membrane for studying the effect of pharmaceutical products.
Abstract: Email has become a fast and cheap means of online
communication. The main threat to email is Unsolicited Bulk Email
(UBE), commonly called spam email. The current work aims at
identification of unigrams in more than 2700 UBE that advertise
body-enhancement drugs. The identification is based on the
requirement that the unigram is neither present in dictionary, nor is a
slang term. The motives of the paper are many fold. This is an
attempt to analyze spamming behaviour and employment of wordmutation
technique. On the side-lines of the paper, we have
attempted to better understand the spam, the slang and their interplay.
The problem has been addressed by employing Tokenization
technique and Unigram BOW model. We found that the non-lexicon
words constitute nearly 66% of total number of lexis of corpus
whereas non-slang words constitute nearly 2.4% of non-lexicon
words. Further, non-lexicon non-slang unigrams composed of 2
lexicon words, form more than 71% of the total number of such
unigrams. To the best of our knowledge, this is the first attempt to
analyze usage of non-lexicon non-slang unigrams in any kind of
UBE.
Abstract: In this paper the authors present the framework of a
system for assisting users through counseling on personal health, the
Personal Health Assistance Service Expert System (PHASES).
Personal health assistance systems need Personal Health Records
(PHR), which support wellness activities, improve the understanding
of personal health issues, enable access to data from providers of
health services, strengthen health promotion, and in the end improve
the health of the population. This is especially important in societies
where the health costs increase at a higher rate than the overall
economy. The most important elements of a healthy lifestyle are
related to food (such as balanced nutrition and diets), activities for
body fitness (such as walking, sports, fitness programs), and other
medical treatments (such as massage, prescriptions of drugs). The
PHASES framework uses an ontology of food, which includes
nutritional facts, an expert system keeping track of personal health
data that are matched with medical treatments, and a comprehensive
data transfer between patients and the system.
Abstract: Severe acute respiratory syndrome (SARS) is a respiratory disease in humans which is caused by the SARS coronavirus. The treatment of coronavirus-associated SARS has been evolving and so far there is no consensus on an optimal regimen. The mainstream therapeutic interventions for SARS involve broad-spectrum antibiotics and supportive care, as well as antiviral agents and immunomodulatory therapy. The Protein- Ligand interaction plays a significant role in structural based drug designing. In the present work we have taken the receptor Angiotensin converting enzyme 2 and identified the drugs that are commonly used against SARS. They are Lopinavir, Ritonavir, Ribavirin, and Oseltamivir. The receptor Angiotensin converting enzyme 2 (ACE-2) was docked with above said drugs and the energy value obtained are as follows, Lopinavir (-292.3), Ritonavir (-325.6), Oseltamivir (- 229.1), Ribavirin (-208.8). Depending on the least energy value we have chosen the best two drugs out of the four conventional drugs. We tried to improve the binding efficiency and steric compatibility of the two drugs namely Ritonavir and Lopinavir. Several modifications were made to the probable functional groups (phenylic, ketonic groups in case of Ritonavir and carboxylic groups in case of Lopinavir respectively) which were interacting with the receptor molecule. Analogs were prepared by Marvin Sketch software and were docked using HEX docking software. Lopinavir analog 8 and Ritonavir analog 11 were detected with significant energy values and are probable lead molecule. It infers that some of the modified drugs are better than the original drugs. Further work can be carried out to improve the steric compatibility of the drug based upon the work done above for a more energy efficient binding of the drugs to the receptor.
Abstract: Camptothecin (CPT) is a cytotoxic quinoline alkaloid,
which inhibits the DNA enzyme topoisomerase I (topo I). It was
discovered in 1966 by M. E. Wall and M. C. Wani in systematic
screening of natural products for anticancer drugs. It was isolated
from the bark and stem of Camptotheca acuminata (Camptotheca,
Happy tree), a tree native in China. CPT showed remarkable
anticancer activity in preliminary clinical trials but also low
solubility and (high) adverse drug reaction. Because of these
disadvantages synthetic and medicinal chemists have developed
numerous syntheses of Camptothecine [1][2][3] and various
derivatives to increase the benefits of the chemical, with good results.
In our method CPT analogues has be six steps starting from available
material DL Malic acid.
Abstract: Nowadays pharmaceutical care departments located in
hospitals are amongst the important pillars of the healthcare system.
The aim of this study was to evaluate quality of hospital drugstores
affiliated with Kermanshah University of Medical Sciences.
In this cross-sectional study a validated questionnaire was used.
The questionnaire was filled in by the one of the researchers in all
seventeen hospital drugstores located in the teaching and nonteaching
hospitals affiliated with Kermanshah University of Medical
Sciences. The results shows that in observed hospitals,24% of
pharmacy environments, 25% of pharmacy store and storage
conditions, 49% of storage procedure, 25% of ordering drugs and
supplies, 73% of receiving supplies (proper procedure are fallowed
for receiving supplies), 35% of receiving supplies (prompt action
taken if deterioration of drugs received is suspected), 23.35% of
drugs delivery to patients and finally 0% of stock cards are used for
proper inventory control have full compliance with standards.