Abstract: Floods play a key role in landform evolution of an
area. This process is likely to alter the topography of the earth’s
surface. The present study area, Kota Bharu is very prone to floods
extends from upstream of Kelantan River near Kemubu to the
downstream area near Kuala Besar. These flood events which occur
every year in the study area exhibit a strong bearing on river
morphological set-up. In the present study, three satellite imageries of
different time periods have been used to manifest the post-flood
landform changes. The pre-processing of the images such as subset,
geometric corrections and atmospheric corrections were carried-out
using ENVI 4.5 followed by the analysis processes. Twenty sets of
cross sections were plotted using software Erdas 9.2, ERDAS and
ArcGis 10 for the all three images. The results show a significant
change in the length of the cross section which suggest that the
geomorphological processes play a key role in carving and shaping
the river banks during the floods.
Abstract: In the UK, flooding is responsible for significant
losses to the economy due to the impact on businesses, the vast
majority of which are Small and Medium Enterprises (SMEs).
Businesses of this nature tend to lack formal plans to aid their
response to and recovery from disruptive events such as flooding.
This paper reports on work on how an agent-based model (ABM) is
being developed based on interview data gathered from SMEs at-risk
of flooding and/or have direct experience of flooding. The ABM will
enable simulations to be performed allowing investigations of
different response strategies which SMEs may employ to lessen the
impact of flooding, thus strengthening their resilience.
Abstract: To evaluate the factors which predetermine the
coronary artery disease in patients having positive Exercise Tolerance
Test (ETT) that is treadmill results and coronary artery findings. This
descriptive study was conducted at Department of Cardiology,
Ibrahim Cardiac Hospital & Research Institute, Dhaka, Bangladesh
from 1st January, 2014 to 31st August, 2014. All patients who had
done ETT (treadmill) for chest pain diagnosis were studied. One
hundred and four patients underwent coronary angiogram after
positive treadmill result. Patients were divided into two groups
depending upon the angiographic findings, i.e. true positive and false
positive. Positive treadmill test patients who have coronary artery
involvement these are called true positive and who have no
involvement they are called false positive group. Both groups were
compared with each other. Out of 104 patients, 81 (77.9%) patients
had true positive ETT and 23 (22.1%) patients had false positive
ETT. The mean age of patients in positive ETT was 53.46± 8.06
years and male mean age was 53.63±8.36 years and female was
52.87±7.0 years. Sixty nine (85.19%) male patients and twelve
(14.81%) female patients had true positive ETT, whereas 15
(65.21%) males and 8 (34.79%) females had false positive ETT, this
was statistically significant (p
Abstract: This paper reports the numerical and experimental
performances of Double Glass Wall are investigated. Two
configurations were considered namely, the Double Clear Glass Wall
(DCGW) and the Double Translucent Glass Wall (DTGW). The
coupled governing equations as well as boundary conditions are
solved using the finite element method (FEM) via COMSOLTM
Multiphysics. Temperature profiles and flow field of the DCGW and
DTGW are reported and discussed. Different constant heat fluxes
were considered as 400 and 800 W.m-2 the corresponding initial
condition temperatures were 30.5 and 38.5ºC respectively. The
results show that the simulation results are in agreement with the
experimental data. Conclusively, the model considered in this study
could reasonable be used simulate the thermal and ventilation
performance of the DCGW and DTGW configurations.
Abstract: India holds 17.5% of the world’s population but has
only 2% of the total geographical area of the world where 27.35% of
the area is categorized as wasteland due to lack of or less
groundwater. So there is a demand for excessive groundwater for
agricultural and non agricultural activities to balance its growth rate.
With this in mind, an attempt is made to find the groundwater
potential zone in Gomukhi Nadhi sub basin of Vellar River basin,
TamilNadu, India covering an area of 1146.6 Sq.Km consists of 9
blocks from Peddanaickanpalayam to Virudhachalam in the sub
basin. The thematic maps such as Geology, Geomorphology,
Lineament, Landuse and Landcover and Drainage are prepared for
the study area using IRS P6 data. The collateral data includes rainfall,
water level, soil map are collected for analysis and inference. The
digital elevation model (DEM) is generated using Shuttle Radar
Topographic Mission (SRTM) and the slope of the study area is
obtained. ArcGIS 10.1 acts as a powerful spatial analysis tool to find
out the ground water potential zones in the study area by means of
weighted overlay analysis. Each individual parameter of the thematic
maps are ranked and weighted in accordance with their influence to
increase the water level in the ground. The potential zones in the
study area are classified viz., Very Good, Good, Moderate, Poor with
its aerial extent of 15.67, 381.06, 575.38, 174.49 Sq.Km respectively.
Abstract: Musculoskeletal injuries in school children could be
reduced improving trunk strength and hamstring flexibility. Low
levels of trunk muscle strength and hamstring flexibility may result in
acute and musculoskeletal chronic diseases. The Pilates Method can
be appropriate to improve these physical condition attributes and has
been rarely employed by this social group. On the other hand, it has
been shown that trunk strength and flexibility are different between
genders, but there is no evidence about the effect of exercise
programs designed to improve both items in school children.
Therefore the objective of this study was to measure the effect of a
six-week Pilates-based exercise program in 14 year old school
children trunk strength and hamstring flexibility, establishing
differences in gender. The sample was composed of 57 students
divided into experimental group (EG; n=30) and control group (CG;
n=27). Bench Trunk Curl test (BTC), Sörensen test and Toe-touch
test (TT) were used to measure dynamic muscular resistance in trunk
flexion, isometric strength in trunk extension and hamstring
flexibility, respectively. EG utilized the Pilates exercise program
during six-weeks (2 days/week, 55minutes/session). After this period
of training, EG improved trunk strength and hamstring flexibility
significantly but there were no significant differences within CG.
Although boys were better in BTC test and girls were better in TT
test, there were no significant differences between them.
Abstract: Roof top rainwater harvesting (RWH) has been
carried out worldwide to provide an inexpensive source of water for
many people. This research aims at evaluating the potential of roof
top rain water harvesting as a resource in Jordan. For the purpose of
this work, two case studies at Al-Jubiha and Shafa-Badran districts in
Amman city were selected. All existing rooftops in both districts
were identified by digitizing 2012 satellite images of the two districts
using Google earth and ArcGIS tools. Rational method was used to
estimate the potential volume of rainwater that can be harvested from
the digitized rooftops. Results indicated that 1.17 and 0.526 MCM/yr
can be harvested in Al-Jubiha and Shafa-Badran districts,
respectively. This study should increase the attention to the
importance of implementing RWH technique in Jordanian residences
as a viable alternative for ensuring a continued source of non-potable
water.
Abstract: It is necessary to manage the fatigue crack growth (FCG) once those cracks are detected during in-service inspections. In this paper, a simulation program (FCG-System) is developed utilizing the commercial software ABAQUS with its object-oriented programming interface to simulate the fatigue crack path and to compute the corresponding fatigue life. In order to apply FCG-System in large-scale marine structures, the substructure modeling technique is integrated in the system under the consideration of structural details and load shedding during crack growth. Based on the nodal forces and nodal displacements obtained from finite element analysis, a formula for shell elements to compute stress intensity factors is proposed in the view of virtual crack closure technique. The cracks initiating from the intersection of flange and the end of the web-stiffener are investigated for fatigue crack paths and growth lives under water pressure loading and axial force loading, separately. It is found that the FCG-System developed by authors could be an efficient tool to perform fatigue crack growth analysis on marine structures.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: We present a deterministic model which describes
the dynamics of tuberculosis in Algerian population where the
vaccination program with BCG is in place since 1969 and where
the WHO recommendations regarding the DOTS (directly-observed
treatment, short course) strategy are in application. The impact
of an intervention program, targeting recently infected people
among all close contacts of active cases and their treatment to
prevent endogenous reactivation, on the incidence of tuberculosis,
is investigated. We showed that a widespread treatment of latently
infected individuals for some years is recommended to shift from
higher to lower equilibrium state and thereafter relaxation is
recommended.
Abstract: The procedure for the assessment of the urinary mucosal cryoglobulin (UMCG) is being reviewed, testified and evaluated. The major features of UMCG are rather similar to that of serum cryoglobulin. Such evident similarities are forming the reality for the existence of the UMCG. There were seven characterizing criteria useable for the identification for UMCG. Upon matching them to the Irish criteria for serum cryoglobulin, some modifications are being proposed to the 16th standards that has been formulated and built as an Irish criteria. The existence of UMCG is being reported for the first time in human chronic infectious bacterial disease.
Abstract: In this study, it was tried to identify some heart rhythm disorders by electrocardiography (ECG) data that is taken from MIT-BIH arrhythmia database by subtracting the required features, presenting to artificial neural networks (ANN), artificial immune systems (AIS), artificial neural network based on artificial immune system (AIS-ANN) and particle swarm optimization based artificial neural network (PSO-NN) classifier systems. The main purpose of this study is to evaluate the performance of hybrid AIS-ANN and PSO-ANN classifiers with regard to the ANN and AIS. For this purpose, the normal sinus rhythm (NSR), atrial premature contraction (APC), sinus arrhythmia (SA), ventricular trigeminy (VTI), ventricular tachycardia (VTK) and atrial fibrillation (AF) data for each of the RR intervals were found. Then these data in the form of pairs (NSR-APC, NSR-SA, NSR-VTI, NSR-VTK and NSR-AF) is created by combining discrete wavelet transform which is applied to each of these two groups of data and two different data sets with 9 and 27 features were obtained from each of them after data reduction. Afterwards, the data randomly was firstly mixed within themselves, and then 4-fold cross validation method was applied to create the training and testing data. The training and testing accuracy rates and training time are compared with each other.
As a result, performances of the hybrid classification systems, AIS-ANN and PSO-ANN were seen to be close to the performance of the ANN system. Also, the results of the hybrid systems were much better than AIS, too. However, ANN had much shorter period of training time than other systems. In terms of training times, ANN was followed by PSO-ANN, AIS-ANN and AIS systems respectively. Also, the features that extracted from the data affected the classification results significantly.
Abstract: Carbon capture, transport and underground storage have become a major solution to reduce CO2 emissions from power plants and other large CO2 sources. A big part of this captured CO2 stream is transported at high pressure dense phase conditions and stored in offshore underground depleted oil and gas fields. CO2 is also transported in offshore pipelines to be used for enhanced oil and gas recovery. The captured CO2 stream with impurities may contain water that causes severe corrosion problems, flow assurance failure and might damage valves and instrumentations. Thus, free water formation should be strictly prevented. The purpose of this work is to study the solubility of water in pure CO2 and in CO2 mixtures under real pipeline pressure (90-150 bar) and temperature operation conditions (5-35°C). A set up was constructed to generate experimental data. The results show the solubility of water in CO2 mixtures increasing with the increase of the temperature or/and with the increase in pressure. A drop in water solubility in CO2 is observed in the presence of impurities. The data generated were then used to assess the capabilities of two mixture models: the GERG-2008 model and the EOS-CG model. By generating the solubility data, this study contributes to determine the maximum allowable water content in CO2 pipelines.
Abstract: The proposed method is to study and analyze Electrocardiograph (ECG) waveform to detect abnormalities present with reference to P, Q, R and S peaks. The first phase includes the acquisition of real time ECG data. In the next phase, generation of signals followed by pre-processing. Thirdly, the procured ECG signal is subjected to feature extraction. The extracted features detect abnormal peaks present in the waveform Thus the normal and abnormal ECG signal could be differentiated based on the features extracted. The work is implemented in the most familiar multipurpose tool, MATLAB. This software efficiently uses algorithms and techniques for detection of any abnormalities present in the ECG signal. Proper utilization of MATLAB functions (both built-in and user defined) can lead us to work with ECG signals for processing and analysis in real time applications. The simulation would help in improving the accuracy and the hardware could be built conveniently.
Abstract: In this paper, steady-state ampacity (current carrying capacity) evaluation of underground power cable system by using analytical and numerical methods for different conditions (depth of cable, spacing between phases, soil thermal resistivity, ambient temperature, wind speed), for two system voltage level were used 132 and 380 kV. The analytical method or traditional method that was used is based on the thermal analysis method developed by Neher-McGrath and further enhanced by International Electrotechnical Commission (IEC) and published in standard IEC 60287. The numerical method that was used is finite element method and it was recourse commercial software based on finite element method.
Abstract: Noise removal techniques play a vital role in the performance of electrocardiographic (ECG) signal processing systems. ECG signals can be corrupted by various kinds of noise such as baseline wander noise, electromyographic interference, and powerline interference. One of the significant challenges in ECG signal processing is the degradation caused by additive 50 or 60 Hz powerline interference. This work investigates the removal of power line interference and suppression of transient response for filtering noise corrupted ECG signals. We demonstrate the effectiveness of infinite impulse response (IIR) notch filter with time varying pole radius for improving the transient behavior. The temporary change in the pole radius of the filter diminishes the transient behavior. Simulation results show that the proposed IIR filter with time varying pole radius outperforms traditional IIR notch filters in terms of mean square error and transient suppression.
Abstract: Nonstationary and nonlinear signals generated by living complex systems defy traditional mechanistic approaches, which are based on homeostasis. Previous our studies have shown that the evaluation of the interactions of physiological signals by using special analysis methods is suitable for observation of physiological processes. It is demonstrated the possibility of using deep physiological model, based on the interpretation of the changes of the human body’s functional states combined with an application of the analytical method based on matrix theory for the physiological signals analysis, which was applied on high risk cardiac patients. It is shown that evaluation of cardiac signals interactions show peculiar for each individual functional changes at the onset of hemodynamic restoration procedure. Therefore, we suggest that the alterations of functional state of the body, after patients overcome surgery can be complemented by the data received from the suggested approach of the evaluation of functional variables’ interactions.
Abstract: Osteoporosis is a complex health disease characterized by low bone mineral density, which is determined by an interaction of genetics with metabolic and environmental factors. Current research in genetics of osteoporosis is focused on identification of responsible genes and polymorphisms. TNFRSF11B gene plays a key role in bone remodeling. The aim of this study was to investigate the genotype and allele distribution of A163G (rs3102735) osteoprotegerin gene promoter and G1181C (rs2073618) osteoprotegerin first exon polymorphisms in the group of 180 unrelated postmenopausal women with diagnosed osteoporosis and 180 normal controls. Genomic DNA was isolated from peripheral blood leukocytes using standard methodology. Genotyping for presence of different polymorphisms was performed using the Custom Taqman®SNP Genotyping assays. Hardy-Weinberg equilibrium was tested for each SNP in the groups of participants using the chi-square (χ2) test. The distribution of investigated genotypes in the group of patients with osteoporosis were as follows: AA (66.7%), AG (32.2%), GG (1.1%) for A163G polymorphism; GG (19.4%), CG (44.4%), CC (36.1%) for G1181C polymorphism. The distribution of genotypes in normal controls were follows: AA (71.1%), AG (26.1%), GG (2.8%) for A163G polymorphism; GG (22.2%), CG (48.9%), CC (28.9%) for G1181C polymorphism. In A163G polymorphism the variant G allele was more common among patients with osteoporosis: 17.2% versus 15.8% in normal controls. Also, in G1181C polymorphism the phenomenon of more frequent occurrence of C allele in the group of patients with osteoporosis was observed (58.3% versus 53.3%). Genotype and allele distributions showed no significant differences (A163G: χ2=0.270, p=0.605; χ2=0.250, p=0.616; G1181C: χ2= 1.730, p=0.188; χ2=1.820, p=0.177). Our results represents an initial study, further studies of more numerous file and associations studies will be carried out. Knowing the distribution of genotypes is important for assessing the impact of these polymorphisms on various parameters associated with osteoporosis. Screening for identification of “at-risk” women likely to develop osteoporosis and initiating subsequent early intervention appears to be most effective strategy to substantially reduce the risks of osteoporosis.
Abstract: This paper deals with modeling and optimization of two NP-hard problems in production planning of flexible manufacturing system (FMS), part type selection problem and loading problem. The part type selection problem and the loading problem are strongly related and heavily influence the system’s efficiency and productivity. These problems have been modeled and solved simultaneously by using real coded genetic algorithms (RCGA) which uses an array of real numbers as chromosome representation. The novel proposed chromosome representation produces only feasible solutions which minimize a computational time needed by GA to push its population toward feasible search space or repair infeasible chromosomes. The proposed RCGA improves the FMS performance by considering two objectives, maximizing system throughput and maintaining the balance of the system (minimizing system unbalance). The resulted objective values are compared to the optimum values produced by branch-and-bound method. The experiments show that the proposed RCGA could reach near optimum solutions in a reasonable amount of time.
Abstract: This paper presents the results of a study aimed at establishing the temperature distribution during the welding of aluminum alloy plates by Pulsed Current Gas Tungsten Arc Welding (PCGTAW) and Constant Current Gas Tungsten Arc Welding (CCGTAW) processes. Pulsing of the GTA welding current influences the dimensions and solidification rate of the fused zone, it also reduces the weld pool volume hence a narrower bead. In this investigation, the base material considered was aluminum alloy AA 6351 T6, which is finding use in aircraft, automobile and high-speed train components. A finite element analysis was carried out using ANSYS, and the results of the FEA were compared with the experimental results. It is evident from the study that the finite element analysis using ANSYS can be effectively used to model PCGTAW process for finding temperature distribution.