Abstract: A collection of thirty cultivars/clones of a red pitaya
was used to investigate flowering response to lighting
supplementation in the winter season of 2013-2014 in southern
Taiwan. The night-breaking treatment was conducted during the
period of 10 Oct. 2013 to 5 Mar. 2014 with 4-continuous hours
(22.00 – 02.00 hrs) of additional lighting daily using incandescent
bulbs (100W). Among cultivars and clones tested, twenty-three
genotypes, most belonging to the red-magenta flesh type, were found
to have positively flowering response to the lighting treatment. The
duration of night-breaking treatment for successful flowering
initiation varied from 33- 48 days. The lighting-sensitive genotypes
bore 1-2 flowering flushes. Floral and fruiting stages took 21-26 and
46-59 days, respectively. Among sixteen fruiting genotypes, the
highest fruit set rates were found in Damao 9, D4, D13, Chaozou
large, Chaozhou 5, Small Nick and F22. Five cultivars and clones
(Orejona, D4, Chaozhou large, Chaozhou 5 and Small Nick) produced
fruits with an average weight of more than 300 g per fruit which were
higher than those of the fruits formed in the summer of 2013. Fruits
produced during off-season containing total soluble solids (TSS)
from 17.5 to 20.7oBrix, which were higher than those produced inseason.
Abstract: This paper presents a combination of both robust
nonlinear controller and nonlinear controller for a class of nonlinear
4Y Octorotor UAV using Back-stepping and sliding mode controller.
The robustness against internal and external disturbance and
decoupling control are the merits of the proposed paper. The
proposed controller decouples the Octorotor dynamical system. The
controller is then applied to a 4Y Octortor UAV and its feature will
be shown.
Abstract: This paper presents observations on the early
supervised internships in Psychology, currently called basic
internships in Brazil, and its importance in professional training. The
work is an experience report and focuses on the Professional training,
illustrated by the reality of a Brazilian institution, used as a case
study. It was developed from the authors' experience as academic
supervisors of this kind of practice throughout this undergraduate
course, combined with aspects investigated in the post-doctoral
research of one of them. Theoretical references on the subject and
related national legislation are analyzed, as well as reports of students
who experienced at least one semester of this type of practice,
articulated to the observations of the authors. The results demonstrate
the importance of the early supervised internships as a way of
creating opportunities for the students of a first contact with the
professional reality and the practice of psychologists in different
fields of insertion, preparing them for further experiments that require
more involvement in activities of training and practices in
Psychology.
Abstract: Knowledge management is considered as an important
factor in improving health care services. KM facilitates the transfer of
existing knowledge and the development of new knowledge in
hospitals. This paper reviews practices adopted by doctors in Kuwait
for capturing, sharing, and generating knowledge. It also discusses
the perceived impact of KM practices on performance of hospitals.
Based on a survey of 277 doctors, the study found that KM practices
among doctors in the sampled hospitals were not very effective. Little
attention was paid to the main activities that support the transfer of
expertise among doctors in hospitals. However, as predicted by
previous studies, good km practices were perceived by doctors to
have a positive impact on performance of hospitals. It was concluded
that through effective KM practices hospitals could improve the
services they provide. Documentation of best practices and capturing
of lessons learnt for re-use of knowledge could help transform the
hospitals into learning organizations.
Abstract: The classroom of the 21st century is an ever changing
forum for new and innovative thoughts and ideas. With increasing
technology and opportunity, students have rapid access to
information that only decades ago would have taken weeks to obtain.
Unfortunately, new techniques and technology are not the cure for
the fundamental problems that have plagued the classroom ever since
education was established. Class size has been an issue long debated
in academia. While it is difficult to pin point an exact number, it is
clear that in this case more does not mean better. By looking into the
success and pitfalls of classroom size the true advantages of smaller
classes will become clear. Previously, one class was comprised of 50
students. Being seventeen and eighteen- year- old students,
sometimes it was quite difficult for them to stay focused. To help
them understand and gain much knowledge, a researcher introduced
“The Theory of Multiple Intelligence” and this, in fact, enabled
students to learn according to their own learning preferences no
matter how they were being taught. In this lesson, the researcher
designed a cycle of learning activities involving all intelligences so
that everyone had equal opportunities to learn.
Abstract: This paper discusses the role of music as a ludic
activity and constituent element of voice in the construction and
consolidation of the relationship of the baby and his/her mother or
caretaker, evaluating its implications in his/her psychic structure and
constitution as a subject. The work was based on the research
developed as part of the author’s doctoral activities carried out from
her insertion in a project of the Music Department of Federal
University of Rio Grande do Sul - UFRGS, which objective was the
development of musical activities with groups of babies from 0 to 24
months old and their caretakers. Observations, video recordings of
the meetings, audio testemonies, and evaluation tools applied to
group participants were used as instruments for this research.
Information was collected on the participation of 195 babies, among
which 8 were more focused on through interviews with their mothers
or caretakers. These interviews were analyzed based on the
referential of French Discourse Analysis, Psychoanalysis, Psychology
of Development and Musical Education. The results of the research
were complemented by other posterior experiences that the author
developed with similar groups, in a context of a private clinic. The
information collected allowed the observation of the ludic and
structural functions of musical activities, when developed in a
structured environment, as well as the importance of the musicality of
the mother’s voice to the psychical structuring of the baby, allowing
his/her insertion in the language and his/her constitution as a subject.
Abstract: Climate warming would increase rainfall by shifting
precipitation falling form from snow to rain, and would accelerate
snow cover disappearing by increasing snowpack. Using temperature
and precipitation data in the temperature-index snowmelt model, we
evaluated variability of snowfall and continuous snow cover duration
(CSCD) during 1944-2010 over Pelso, central Finland. Mann-
Kendall non-parametric test determined that annual precipitation
increased by 2.69 (mm/year, p
Abstract: This article presents a new vibration diagnostic
method designed to (PM) machines with permanent magnets. Those
devices are commonly used in small wind and water systems or
vehicles drives. The author’s method is very innovative and unique.
Specific structural properties of PM machines are used in this method
- electromotive force (EMF) generated due to vibrations. There was
analysed number of publications which describe vibration diagnostic
methods and tests of electrical PM machines and there was no
method found to determine the technical condition of such machine
basing on their own signals. In this article will be discussed: the
method genesis, the similarity of machines with permanent magnet to
vibration sensor and simulation and laboratory tests results. The
method of determination the technical condition of electrical machine
with permanent magnets basing on its own signals is the subject of
patent application and it is the main thesis of author’s doctoral
dissertation.
Abstract: Calcium phosphate coating (CaP) has been employed
for protein delivery, but the typical direct protein adsorption on the
coating led to low incorporation content and fast release of the
protein from the coating. By using bovine serum albumin (BSA) as a
model protein, rapid biomimetic co-precipitation between calcium
phosphate and BSA was employed to control the distribution of BSA
within calcium phosphate coating during biomimetic formation on
titanium surface for only 6 h at 50oC in an accelerated calcium
phosphate solution. As a result, the amount of BSA incorporation and
release duration could be increased by using a rapid biomimetic coprecipitation
technique. Up to 43 fold increases in the BSA
incorporation content and the increase from 6 h to more than 360 h in
release duration compared to typical direct adsorption technique were
observed depending on the initial BSA concentration used during coprecipitation
(1, 10 and 100 μg.ml-1). From x-ray diffraction and
Fourier transform infrared spectroscopy studies, the coating
composition was not altered with the incorporation of BSA by this
rapid biomimetic co-precipitation and mainly comprised octacalcium
phosphate and hydroxyapatite. However, the microstructure of
calcium phosphate crystals changed from straight, plate-like units to
curved, plate-like units with increasing BSA content.
Abstract: Kinematic data wisely correlate vector quantities in
space to scalar parameters in time to assess the degree of symmetry
between the intact limb and the amputated limb with respect to a
normal model derived from the gait of control group participants.
Furthermore, these particular data allow a doctor to preliminarily
evaluate the usefulness of a certain rehabilitation therapy.
Kinetic curves allow the analysis of ground reaction forces (GRFs)
to assess the appropriateness of human motion.
Electromyography (EMG) allows the analysis of the fundamental
lower limb force contributions to quantify the level of gait
asymmetry. However, the use of this technological tool is expensive
and requires patient’s hospitalization. This research work suggests
overcoming the above limitations by applying artificial neural
networks.
Abstract: Paper deals with analysis of strategic management
methods in non-profit making organization in the Czech Republic.
Strategic management represents an aggregate of methods and
approaches that can be applied for managing organizations - in this
article the organizations which associate owners and keepers of nonstate
forest properties. Authors use these methods of strategic
management: analysis of stakeholders, SWOT analysis and
questionnaire inquiries. The questionnaire was distributed
electronically via e-mail. In October 2013 we obtained data from a
total of 84 questionnaires. Based on the results the authors
recommend the using of confrontation strategy which improves the
competitiveness of non-profit making organizations.
Abstract: The fight against climate change and the replacement
of fossil energies nearing exhaustion gradually emerge as major
societal and economic challenges. It is possible to develop common
dates of low commercial value, and put on the local and international
market a new generation of products with high added values such as
bio ethanol. Besides its use in chemical synthesis, bio ethanol can be
blended with gasoline to produce a clean fuel while improving the
octane.
Abstract: Obesity, stunting and wasting problems among Thai school-aged children are increasing due to inappropriate food consumption behavior and poor environments for desirable nutritional behavior. Because of a low school lunch budget of only 0.40 USD per person per day, food quality is not up to nutritional standards. Therefore, the Health Department with the Education Ministry and the Thai Health Promotion Foundation have developed a quality school lunch project during 2009–2013. The program objectives were development and management of public policy to increase school lunch budget. The methods used a healthy public policy motivation process and movement in 241 local administrative organizations and 538 schools. The problem and solution research was organized to study school food and nutrition management, create a best practice policy mobilization model and hold a public hearing to motivate an increase of school meal funding. The results showed that local public policy has been motivated during 2009-2011 to increase school meal budget using local budgets. School children with best food consumption behavior and exercise increased from 13.2% in 2009 to 51.6% in 2013 and stunting decreased from 6.0% in 2009 to 4.7% in 2013. As the result of national policy motivation (2012-2013), the cabinet meeting on October 22, 2013 has approved an increase of school lunch budget from 0.40 USD to 0.62 USD per person per day. Thus, 5,800,469 school children nationwide have benefited from the budget increase.
Abstract: In this study, a liquid phase microextraction by hollow fiber (HF-LPME) combined with high performance liquid chromatography-UV detector was applied to preconcentrate and determine trace levels of Cyproheptadine in human urine and plasma samples. Cyproheptadine was extracted from 10 mL alkaline aqueous solution (pH: 9.81) into an organic solvent (n-octnol) which was immobilized in the wall pores of a hollow fiber. Then was back-extracted into an acidified aqueous solution (pH: 2.59) located inside the lumen of the hollow fiber. This method is simple, efficient and cost-effective. It is based on pH gradient and differences between two aqueous phases. In order to optimize the HF-LPME some affecting parameters including the pH of donor and acceptor phases, the type of organic solvent, ionic strength, stirring rate, extraction time and temperature were studied and optimized. Under optimal conditions enrichment factor, limit of detection (LOD) and relative standard deviation (RSD(%), n=3) were up to 112, 15 μg.L−1 and 2.7, respectively.
Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The process in which the complementary information from multiple images is integrated to provide composite image that contains more information than the original input images is called image fusion. Medical image fusion provides useful information from multimodality medical images that provides additional information to the doctor for diagnosis of diseases in a better way. This paper represents the wavelet based medical image fusion algorithm on different multimodality medical images. In order to fuse the medical images, images are decomposed using Redundant Wavelet Transform (RWT). The high frequency coefficients are convolved with morphological operator followed by the maximum-selection (MS) rule. The low frequency coefficients are processed by MS rule. The reconstructed image is obtained by inverse RWT. The quantitative measures which includes Mean, Standard Deviation, Average Gradient, Spatial frequency, Edge based Similarity Measures are considered for evaluating the fused images. The performance of this proposed method is compared with Pixel averaging, PCA, and DWT fusion methods. When compared with conventional methods, the proposed framework provides better performance for analysis of multimodality medical images.
Abstract: The objective of presenting this article is to analyze between Thai’s film and Thai society in political crisis, to study the development and trend of the film which reflects society in Thailand from political crisis of 14 October 1973 and the present day political crisis using a comparative study of the two era, both the similarities and differences in the film reflects the society in an era of change.
Abstract: This research aims to study the species, feeding behavior and activity characteristics of birds which reap benefits from the research area in boat touring routes in Klong Kone Sub-district, Muang District, Samut Songkram Province, Thailand from October 2013 – May 2014. The results from the survey of birds on all three routes found that there are 11 families and 22 species. Route 1 (Klong Kone canal) had the most species, 20 species. According to feeding behavior, there were insectivorous, piscivorous and aquatic invertebrate feeder birds. Activity characteristics of birds which reap benefits from the research were finding food, nesting and raise nestlings along boat touring routes.
Abstract: This research aims to study species, abundance, status
of birds, the similarities and activity characteristics of birds which
reap benefits from the research area in boat touring routes in Tha Ka
sub-district, Amphawa District, Samut Songkram Province, Thailand.
from October 2012 – September 2013. The data was analyzed to find
the abundance, and similarity index of the birds. The results from the
survey of birds on all three routes found that there are 33 families and
63 species. Route 3 (traditional coconut sugar making kiln – resort)
had the most species; 56 species. There were 18 species of commonly
found birds with an abundance level of 5, which calculates to 28.57%
of all bird species. In August, 46 species are found, being the greatest
number of bird species benefiting from this route. As for the status of
the birds, there are 51 resident birds, 7 resident and migratory birds,
and 5 migratory birds. On Route 2 and Route 3, the similarity index
value is equal to 0.881. The birds are classified by their activity
characteristics i.e. insectivore, piscivore, granivore, nectrivore and
aquatic invertebrate feeder birds. Some birds also use the area for
nesting.