Abstract: This research aims to study tourism data and behavior
of foreign tourists visited Wat Phrachetuponwimolmangkalaram (Wat
Po) Sample groups are tourists who visited inside the temple, during
February, March, April and May 2013. Tools used in the research are
questionnaires constructed by the researcher, and samples are dawn
by Convenience sampling. There are 207 foreign tourists who are
willing to be respondents. Statistics used are percentage, average
mean and standard deviation.
The results of the research reveal that:
A. General Data of Respondents
The foreign tourists who visited the temple are mostly female
(57.5 %), most respondents are aged between 20-29 years (37.2%).
Most respondents live in Europe (62.3%), most of them got the
Bachelor’s degree (40.1%), British are mostly found (16.4%),
respondents who are students are also found (23.2%), and Christian
are mostly found (60.9%).
B. Tourists’ Behavior While Visiting the Temple Compound.
The result shows that the respondents came with family (46.4%),
have never visited the temples (40.6%), and visited once (42 %). It is
found that the foreign tourists’ inappropriate behavior are wearing
revealing attires (58.9%), touching or getting closed to the monks
(55.1%), and speaking loudly (46.9%) respectively.
The respondents’ outstanding objectives are to visit inside the
temple (57.5%), to pay respect to the Reclining Buddha Image in the
Viharn (44.4%) and to worship the Buddha image in the Phra Ubosod
(37.7%) respectively.
C. The Respondents’ Self-evaluation of Performance
It is found that over all tourists evaluated themselves in the highest
level averaged 4.40. When focusing on each item, it is shown that
they evaluated themselves in the highest level on obeying the temple
staff averaged 4.57, and cleanness concern of the temple averaged
4.52, well-behaved performance during the temple visit averaged
4.47 respectively.
Abstract: High resolution seismic reflection has recently been carried out on Zaria batholith, with the aim of characterizing the granitic Zaria batholiths in terms of its lithology. The geology of the area has revealed that the older granite outcrops in the vicinity of Zaria are exposures of a syntectonics to late-tectonic granite batholiths which intruded a crystalline gneissic basement during the Pan-African Orogeny. During the data acquisition the geophone were placed at interval of 1 m, variable offset of 1 and 10 m was used. The common midpoint (CMP) method with 12 fold coverage was employed for the survey. Analysis of the generated 3D surface of the p wave velocities from different profiles for densities and bulk modulus revealed that the rock material is more consolidated in South East part of the batholith and less consolidated in the North Western part. This was in conformity with earlier identified geology of the area, with the South Eastern part majorly of granitic outcrop, while the North Western part is characterized with the exposure of gneisses and thick overburden cover. The difference in lithology was also confirmed by the difference in seismic sections and Arial satellite photograph. Hence two major lithologies were identified, the granitic and gneisses complex which are characterized by gradational boundaries.
Abstract: Tsunami early detection and warning systems have proved to be of ultimate importance, especially after the destructive tsunami that hit Japan in March 2012. Such systems are crucial to inform the authorities of any risk of a tsunami and of the degree of its danger in order to make the right decision and notify the public of the actions they need to take to save their lives. The purpose of this research is to enhance existing tsunami detection and warning systems. We first propose an automated and miniaturized model of an early tsunami detection and warning system. The model for the operation of a tsunami warning system is simulated using the data acquisition toolbox of Matlab and measurements acquired from specified internet pages due to the lack of the required real-life sensors, both seismic and hydrologic, and building a graphical user interface for the system. In the second phase of this work, we implement various satellite image filtering schemes to enhance the acquired synthetic aperture radar images of the tsunami affected region that are masked by speckle noise. This enables us to conduct a post-tsunami damage extent study and calculate the percentage damage. We conclude by proposing improvements to the existing telecommunication infrastructure of existing warning tsunami systems using a migration to IP-based networks and fiber optics links.
Abstract: In this paper, we employ a directed hypergraph model
to investigate the extent to which environmental variability influences
the set of available biochemical reactions within a living cell.
Such an approach avoids the limitations of the usual complex
network formalism by allowing for the multilateral relationships (i.e.
connections involving more than two nodes) that naturally occur
within many biological processes. More specifically, we extend the
concept of network reciprocity to complex hyper-networks, thus
enabling us to characterise a network in terms of the existence
of mutual hyper-connections, which may be considered a proxy
for metabolic network complexity. To demonstrate these ideas, we
study 115 metabolic hyper-networks of bacteria, each of which
can be classified into one of 6 increasingly varied habitats.
In particular, we found that reciprocity increases significantly
with increased environmental variability, supporting the view that
organism adaptability leads to increased complexities in the resultant
biochemical networks.
Abstract: This research aims to critical analyze the feminine violent within Thai daily newspaper. This study was qualitative base; content analysis from two popular newspapers (Thairath and Dailynews) two qualitative newspapers (Thaipost and Mathichon). Purposive sampling was used to select eleven specialize news reporters to do in-depth interview. The result found that, popular newspapers, Thairath and dailynews have presented feminine violent news in their paper more than Thaipost and Mathichon the qualitative newspaper. Beside, majority of sample present the feminine violent within news under the code of ethic, The National Press Council of Thailand. Interesting, the age of feminine violent victim was the information that has been focused most. The popular newspaper have illustrated crime scene photo on their first-page while qualitative newspaper used only headline to present the same news.
Abstract: With the advances in information and communications technology, mobile context-aware applications have become powerful marketing tools. In Apple online store, there are numerous mobile applications (APPs) developed for destination tour. This study investigated the determinants of adoption of context-aware APPs for destination tour services. A model is proposed based on Technology Acceptance Model and privacy concern theory. The model was empirically tested based on a sample of 259 users of a tourism APP published by Kaohsiung Tourism Bureau, Taiwan. The results showed that the fitness of the model is well and, among all the factors, the perceived usefulness and perceived ease of use have the most significant influences on the intention to adopt context-aware destination APPs. Finally, contrary to the findings of previous literature, the effect of privacy concern on the adoption intention of context-aware APP is insignificant.
Abstract: Many organizations are opting to adopt Open Source Software (OSS) as it is the current trend to rely on each other rather than on companies (Software vendors). It is a clear shift from organizations to individuals, the concept being to rely on collective participation rather than companies/vendors.
The main objectives of this research are 1) to identify the current level of OSS usage in Sultan Qaboos University; 2) to identify the potential benefits of using OSS in educational institutes; 3) to identify the OSS applications that are most likely to be used within an educational institute; 4) to identify the existing and potential barriers to the successful adoption of OSS in education.
To achieve these objectives a two-stage research method was conducted. First a rigorous literature review of previously published material was performed (interpretive/descriptive approach), and then a set of interviews were conducted with the IT professionals at Sultan Qaboos University in Oman in order to explore the extent and nature of their usage of OSS.
Abstract: The rapid development and growth of technology has changed the method of obtaining information for educators and learners. Technology has created a new world of collaboration and communication among people. Incorporating new technology into the teaching process can enhance learning outcomes. Billions of individuals across the world are now connected together, and are cooperating and contributing their knowledge and intelligence. Time is no longer wasted in waiting until the teacher is ready to share information as learners can go online and get it immediatelt.
The objectives of this paper are to understand the reasons why changes in teaching and learning methods are necessary, to find ways of improving them, and to investigate the challenges that present themselves in the adoption of new ICT tools in higher education institutes.
To achieve these objectives two primary research methods were used: questionnaires, which were distributed among students at higher educational institutes and multiple interviews with faculty members (teachers) from different colleges and universities, which were conducted to find out why teaching and learning methodology should change.
The findings show that both learners and educators agree that educational technology plays a significant role in enhancing instructors’ teaching style and students’ overall learning experience; however, time constraints, privacy issues, and not being provided with enough up-to-date technology do create some challenges.
Abstract: The extracellular proteins secreted by bacteria may be increased in stressful surroundings, such as in the presence of antibiotics. It appears that many antibiotics, when used at low concentrations, have in common the ability to activate or repress gene transcription, which is distinct from their inhibitory effect. There have been comparatively few studies on the potential of antibiotics as a specific chemical signal that can trigger a variety of biological functions. Therefore, this study was carried out to determine the effect of Streptomycin Sulfate in regulating extracellular proteins secreted by Bacillus subtilis ATCC21332. Results of Microdilution assay showed that the Minimum Inhibition Concentration (MIC) of Streptomycin Sulfate on B. subtilis ATCC21332 was 2.5 mg/ml. The bacteria cells were then exposed to Streptomycin Sulfate at concentration of 0.01 MIC before being further incubated for 48h to 72 h. The extracellular proteins secreted were then isolated and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins profile revealed that three additional bands with approximate sizes of 30 kDa, 22 kDa and 23 kDa were appeared for the treated bacteria with Streptomycin Sulfate. Thus, B. subtilis ATCC21332 in stressful condition with the presence of Streptomycin Sulfate at low concentration could induce the extracellular proteins secretion.
Abstract: Water is a fundamental attraction in all cultures and among all classes of people,tourists and citizens. It is a favorite location for major tourism initiatives, celebrations and ceremonies. The vitality of any city depends on citizen action to take part in creating the neighborhoods they desire. Waterfront can provide extensive new areas of high quality public open space in parts of the city that are popular venues for social activities and also have the highest land values. Each city must have a character that can be used as a key attraction for the development. The morphology of a waterfront can be identified by both its physical characteristics and the socio-cultural activities that take place in the area. Alexandria has been selected as an area of study because it has a unique character due to its possession of a variety of waterfronts.
This paper aims to set some criteria of successful waterfront development and then through these criteria analyzing the development of the Qaitbay waterfront in the eastern harbor in Alexandria, Egypt. Hence, a comprehensive improvement of the waterfront areas is certainly needed to ensure a successful waterfront development radiated the sense of uniformity and coherence.
Alexandria can benefit from these criteria to develop its urban waterfront in order to preserve and revitalize its unique waterfront character and achieve mixed uses and tourism development.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The copyrights system is a combination of different elements. The number, content and the correlation of these elements are different for different legal orders. The models of copyrights systems display this system in terms of the interaction of economic and author's moral rights. Monistic and dualistic models are the most popular ones. The article deals with different points of view on the monism and dualism in copyright system. A specific model of the copyright in Switzerland in the XXth century is analyzed. The evolution of a French dualistic model of copyright is shown. The author believes that one should talk not about one, but rather about a number of dualism forms of copyright system.
Abstract: We present results from experimental price-setting oligopolies in which green firms undertake different levels of energy-saving investments motivated by public subsidies and demand-side advantages. We find that consumers reveal higher willingness to pay for greener sellers’ products. This observation in conjunction to the fact that greener sellers set higher prices is compatible with the use and interpretation of energy-saving behaviour as a differentiation strategy. However, sellers do not exploit the resulting advantage through sufficiently high price-cost margins, because they seem trapped into “run to stay still” competition. Regarding the use of public subsidies to energy-saving sellers we uncover an undesirable crowding-out effect of consumers’ intrinsic tendency to support green manufacturers. Namely, consumers may be less willing to support a green seller whose energy-saving strategy entails a direct financial benefit. Finally, we disentangle two alternative motivations for consumer’s attractions to pro-social firms; first, the self-interested recognition of the firm’s contribution to the public and private welfare and, second, the need to compensate a firm for the cost entailed in each pro-social action. Our results show the prevalence of the former over the latter.
Abstract: There are several types of metal-based devices conceived as dampers for the seismic energy absorber whereby damages to the major structural components could be minimized for both new and existing structures. This paper aimed to develop and evaluate structural performance of slit circular shear panel damper for passive seismic energy protection by inelastic deformation. Structural evaluation was done using commercially available nonlinear FE simulation program. The main parameters considered are: diameter-to-thickness (D/t) ratio and slit length-to-width ratio (l/w). Depending on these parameters three different buckling mode and hysteretic behavior was found: yielding prior to buckling without strength degradation, yielding prior to buckling with strength degradation and yielding with buckling and strength degradation which forms pinching at initial displacement. The susceptible location at which the possible crack is initiated is also identified for selected specimens using rupture index.
Abstract: Object detection using Wavelet Neural Network (WNN) plays a major contribution in the analysis of image processing. Existing cluster-based algorithm for co-saliency object detection performs the work on the multiple images. The co-saliency detection results are not desirable to handle the multi scale image objects in WNN. Existing Super Resolution (SR) scheme for landmark images identifies the corresponding regions in the images and reduces the mismatching rate. But the Structure-aware matching criterion is not paying attention to detect multiple regions in SR images and fail to enhance the result percentage of object detection. To detect the objects in the high-resolution remote sensing images, Tagged Grid Matching (TGM) technique is proposed in this paper. TGM technique consists of the three main components such as object determination, object searching and object verification in WNN. Initially, object determination in TGM technique specifies the position and size of objects in the current image. The specification of the position and size using the hierarchical grid easily determines the multiple objects. Second component, object searching in TGM technique is carried out using the cross-point searching. The cross out searching point of the objects is selected to faster the searching process and reduces the detection time. Final component performs the object verification process in TGM technique for identifying (i.e.,) detecting the dissimilarity of objects in the current frame. The verification process matches the search result grid points with the stored grid points to easily detect the objects using the Gabor wavelet Transform. The implementation of TGM technique offers a significant improvement on the multi-object detection rate, processing time, precision factor and detection accuracy level.
Abstract: Present research investigates eclecticism in Iranian
theatre on the basis of eclectic theory. Eclectic theatre is a new theory
in postmodernism. The theory appeared during 60th – 70th century in
some theatres such as “Conference of the Birds”.
Special theatrical forms have been developed in many
geographical- cultural areas of the world and are indigenous to that
area. These forms, as compared with original forms, are considered to
be traditional while being comprehensive, the form is considered to
be national. Kaboudan and Sfandiar theatre has been influenced by
elements of traditional form of Iran.
Abstract: To measure or asses any government’s efficiency we need to measure the performance of this government in regards to the quality of the service it provides. Using a technological platform in service provision became a trend and a public demand. It is also a public need to make sure these services are aligned to values and to the whole government’s strategy, vision and goals as well. Providing services using technology tools and channels can enhance the internal business process and also help establish many essential values to government services like transparency and excellence, since in order to establish e-services many standards and policies must be put in place to enable the handing over of decision making to a mature system oriented mechanism. There was no doubt that the Sultanate of Oman wanted to enhance its services and move it towards automation and establishes a smart government as well as links its services to life events. Measuring government efficiency is very essential in achieving social security and economic growth, since it can provide a clear dashboard of all projects and improvements. Based on this data we can improve the strategies and align the country goals to them.
Abstract: The purposes of this research were (1) to create a
learning activity for constructivism, (2) study the Mathematical
Analysis courses learning achievement, and (3) study students’
attitude toward the learning activity for constructivism. The samples
in this study were divided into 2 parts including 3 Mathematical
Analysis courses instructors of Suan Sunandha Rajabhat University
who provided basic information and attended the seminar and 17
Mathematical Analysis courses students who were studying in the
academic and engaging in the learning activity for constructivism.
The research instruments were lesson plans constructivism,
subjective Mathematical Analysis courses achievement test with
reliability index of 0.8119, and an attitude test concerning the
students’ attitude toward the Mathematical Analysis courses learning
activity for constructivism. The result of the research show that the
efficiency of the Mathematical Analysis courses learning activity for
constructivism is 73.05/72.16, which is more than expected criteria of
70/70. The research additionally find that the average score of
learning achievement of students who engaged in the learning
activities for constructivism are equal to 70% and the students’
attitude toward the learning activity for constructivism are at the
medium level.
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.
Abstract: The objective of presenting this article is to analyze between Thai’s film and Thai society in political crisis, to study the development and trend of the film which reflects society in Thailand from political crisis of 14 October 1973 and the present day political crisis using a comparative study of the two era, both the similarities and differences in the film reflects the society in an era of change.