Abstract: Surplus electricity can be converted into potential energy via pumped hydroelectric storage for future usage. Similarly, thermo-electric energy storage (TEES) uses heat pumps equipped with thermal storage to convert electrical energy into thermal energy; the stored energy is then converted back into electrical energy when necessary using a heat engine. The greatest advantage of this method is that, unlike pumped hydroelectric storage and compressed air energy storage, TEES is not restricted by geographical constraints. In this study, performance variation of the TEES according to the changes in cold-side storage temperature was investigated by simulation method.
Abstract: Ferulic acid has widespread industrial potential by virtue of its antioxidant properties. However, it is partially soluble in aqueous media, limiting their usefulness in oil-based processes in food, cosmetic, pharmaceutical, and material industry. Therefore, modification of ferulic acid should be made by producing of more lipophilic derivatives. In this study, a preliminary investigation of lipase-catalyzed trans-esterification reaction of ethyl ferulate and olive oil was investigated. The reaction was catalyzed by immobilized lipase from Candida antarctica (Novozym 435), to produce ferulate ester, a sunscreen agent. A statistical approach of Response surface methodology (RSM) was used to evaluate the interactive effects of reaction temperature (40-80°C), reaction time (4-12 hours), and amount of enzyme (0.1-0.5 g). The optimum conditions derived via RSM were reaction temperature 60°C, reaction time 2.34 hours, and amount of enzyme 0.3 g. The actual experimental yield was 59.6% ferulate ester under optimum condition, which compared well to the maximum predicted value of 58.0%.
Abstract: Blood gamma irradiation is the only available method
to prevent transfusion associated graft versus host disease (TAGVHD).
However, when blood is irradiated, determine blood shelf
time is crucial. Non irradiated blood have a self-time from 21 to 35
days when is preserved with anticoagulated solution and stored at
4°C. During their storage, red blood cells (RBC) undergo a series of
biochemical, biomechanical and molecular changes involving what is
known as storage lesion (SL). SL include loss of structural integrity
of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and
increase of both ion potassium concentration and hemoglobin (Hb).
On the other hand, Atomic force Microscopy (AFM) represents a
versatile tool for a nano-scale high resolution topographic analysis in
biological systems. In order to evaluate SL in irradiated and nonirradiated
blood, RBC topography and morphometric parameters
were obtained from an AFM XE-BIO system. Cell viability was
followed using flow cytometry. Our results showed that early
markers as nanoscale roughness, allow us to evaluate blood quality
since other perspective.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: In recent years, geographic information systems (GIS)
and remote sensing using has increased to estimate runoff catchment.
In this research, runoff curve number maps for captive catchment of
Tehran by helping GIS and also remote sensing which based on
factors such as vegetation, lands using, group of soil hydrology and
hydrological conditions were obtained. Runoff curve numbers map
was obtained by combining these maps in ARC GIS and SCS table.
To evaluate the accuracy of the results, the maximum flow rate of
flood which was obtained from curve numbers, was compared with
the measured maximum flood rate at the watershed outlet and
correctness of curve numbers were approved.
Abstract: This study compared the mechanical and microstructural properties produced during friction stir welding (FSW) of S275 structural steel in air and underwater. Post weld tests assessed the tensile strength, micro-hardness, distortion, Charpy impact toughness and fatigue performance in each case. The study showed that there was no significant difference in the strength, hardness or fatigue life of the air and underwater specimens. However, Charpy impact toughness was shown to decrease for the underwater specimens and was attributed to a lower degree of recrystallization caused by the higher rate of heat loss experienced when welding underwater. Reduced angular and longitudinal distortion was observed in the underwater welded plate compared to the plate welded in air.
Abstract: An investigation of adaptable winglets for morphing
aircraft control and performance is described in this paper. The
concepts investigated consist of various winglet configurations
fundamentally centred on a baseline swept wing. The impetus for the
work was to identify and optimize winglets to enhance controllability
and the aerodynamic efficiency of a small unmanned aerial vehicle.
All computations were performed with Athena Vortex Lattice
modelling with varying degrees of twist, swept, and dihedral angle
considered. The results from this work indicate that if adaptable
winglets were employed on small scale UAV’s improvements in both
aircraft control and performance could be achieved.
Abstract: Small and medium-sized enterprises (SME) are the backbone of central Europe’s economies and have a significant contribution to the gross domestic product. Production planning and scheduling (PPS) is still a crucial element in manufacturing industries of the 21st century even though this area of research is more than a century old. The topic of PPS is well researched especially in the context of large enterprises in the manufacturing industry. However the implementation of PPS methodologies within SME is mostly unobserved. This work analyzes how PPS is implemented in SME with the geographical focus on Switzerland and its vicinity. Based on restricted resources compared to large enterprises, SME have to face different challenges. The real problem areas of selected enterprises in regards of PPS are identified and evaluated. For the identified real-life problem areas of SME clear and detailed recommendations are created, covering concepts and best practices and the efficient usage of PPS. Furthermore the economic and entrepreneurial value for companies is lined out and why the implementation of the introduced recommendations is advised.
Abstract: This research presents the design, fabrication and application of a flavor sensor for an integrated electronic tongue and electronic nose that can allow rapid characterization of multi-component mixtures in a solution. The odor gas and liquid are separated using hydrophobic porous membrane in micro fluidic channel. The sensor uses an array composed of microbeads in micromachined cavities localized on silicon wafer. Sensing occurs via colorimetric and fluorescence changes to receptors and indicator molecules that are attached to termination sites on the polymeric microbeads. As a result, the sensor array system enables simultaneous and near-real-time analyses using small samples and reagent volumes with the capacity to incorporate significant redundancies. One of the key parts of the system is a passive pump driven only by capillary force. The hydrophilic surface of the fluidic structure draws the sample into the sensor array without any moving mechanical parts. Since there is no moving mechanical component in the structure, the size of the fluidic structure can be compact and the fabrication becomes simple when compared to the device including active microfluidic components. These factors should make the proposed system inexpensive to mass-produce, portable and compatible with biomedical applications.
Abstract: The application of today's semiconductor transistors in high power UHF DVB-T linear amplifiers has evolved significantly by utilizing LDMOS technology. This fact provides engineers with the option to design a single transistor signal amplifier which enables output power and linearity that was unobtainable previously using bipolar junction transistors or later type first generation MOSFETS. The quiescent current stability in terms of thermal variations of the LDMOS guarantees a robust operation in any topology of DVB-T signal amplifiers. Otherwise, progressively uncontrolled heat dissipation enhancement on the LDMOS case can degrade the amplifier’s crucial parameters in regards to the gain, linearity and RF stability, resulting in dysfunctional operation or a total destruction of the unit. This paper presents one more sophisticated approach from the traditional biasing circuits used so far in LDMOS DVB-T amplifiers. It utilizes a microprocessor control technology, providing stability in topologies where IDQ must be perfectly accurate.
Abstract: Present research investigates eclecticism in Iranian
theatre on the basis of eclectic theory. Eclectic theatre is a new theory
in postmodernism. The theory appeared during 60th – 70th century in
some theatres such as “Conference of the Birds”.
Special theatrical forms have been developed in many
geographical- cultural areas of the world and are indigenous to that
area. These forms, as compared with original forms, are considered to
be traditional while being comprehensive, the form is considered to
be national. Kaboudan and Sfandiar theatre has been influenced by
elements of traditional form of Iran.
Abstract: The study aimed to collect morphological data of
secretory structures that contribute to taxonomy of Indigofera. Detail
features of trichomes occurrence in vegetative and reproductive
organs of Indigofera wightii Grah. ex Wigh & Arn., a species
traditionally used as source of indigo to dye “Thaisongdam” clothing
were investigated. Examination through light microscopy and
scanning electrom microscopy were done. Non secretory, T-shaped
trichomes appeared throughout surfaces of stems, leaves, flowers and
fruits. Secretory or glandular trichomes occurred in two types; one
has big cylindrical head and short peduncle, distributed on adaxial
surface of sepals and around the pedicel, whereas another possesses
smaller cylindrical head but long peduncle. The latter was found on
apical surface of immature pods. No phenolic and lipophilic
compounds were detected from these glands.
Abstract: This paper provides an analysis of the insurance cycle in the Republic of Croatia and whether they are affected by catastrophic losses on a global level. In general, it is considered that insurance cycles are particularly pronounced in periods of financial crisis, but are also affected by the growing number of catastrophic losses. They cause the change of insurance cycle and premium growth and intensification and narrowing of the coverage conditions, so these variables move in the same direction and these phenomena point to a new cycle. The main goal of this paper is to determine the existence of insurance cycle in the Republic of Croatia and investigate whether catastrophic losses have an influence on insurance cycles.
Abstract: Recent growth in digital multimedia technologies has presented a lot of facilities in information transmission, reproduction and manipulation. Therefore, the concept of information security is one of the superior articles in the present day situation. The biometric information security is one of the information security mechanisms. It has the advantages as well as disadvantages. The biometric system is at risk to a range of attacks. These attacks are anticipated to bypass the security system or to suspend the normal functioning. Various hazards have been discovered while using biometric system. Proper use of steganography greatly reduces the risks in biometric systems from the hackers. Steganography is one of the fashionable information hiding technique. The goal of steganography is to hide information inside a cover medium like text, image, audio, video etc. through which it is not possible to detect the existence of the secret information. Here in this paper a new security concept has been established by making the system more secure with the help of steganography along with biometric security. Here the biometric information has been embedded to a skin tone portion of an image with the help of proposed steganographic technique.
Abstract: In review the generalized data about different methods of synthesis of biological activity acylatedhydrohyanthraquinones is presented. The basic regularity of a synthesis is analyzed. Action of temperature, pH, solubility, catalysts and other factors on a reaction product yield is revealed.
Abstract: In the present study, RAPD-PCR was used to assess genetic diversity of the rye including landrances and new rye cultivars coming from Central Europe and the Union of Soviet Socialist Republics (SUN). Five arbitrary random primers were used to determine RAPD polymorphism in the set of 38 rye genotypes. These primers amplified altogether 43 different DNA fragments with an average number of 8.6 fragments per genotypes. The number of fragments ranged from 7 (RLZ 8, RLZ 9 and RLZ 10) to 12 (RLZ 6). DI and PIC values of all RAPD markers were higher than 0.8 that generally means high level of polymorphism detected between rye genotypes. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared. The cultivars were grouped into two main clusters. In this experiment, RAPD proved to be a rapid, reliable and practicable method for revealing of polymorphism in the rye cultivars.
Abstract: The work delineates the threats of maladjustment of the capacity of rain canals, designed and built in the early 20th century, in connection to heavy rainfall, especially in summer. This is the cause of the so called 'urban floods.' It directly relates to fierce raise of paving in the cities. Resolving this problem requires a change in philosophy of draining the rainfall by wider use of retention, infiltration and usage of rainwater.
In systemic approach to managing the safety of urban drainage systems the risk, which is directly connected to safety failures, has been accepted as a measure. The risk level defines the probability of occurrence of losses greater than the ones forecast for a given time frame. The procedure of risk modelling, enabling its numeric analysis by using appropriate weights, is a significant issue in this paper.
Abstract: This research intended to develop the model of community management for sustainable utilization by investigating on 2 groups of population, the family heads and the community management team. The population of the former group consisted of family heads from 511 families in 12 areas to complete the questionnaires which were returned at 479 sets. The latter group consisted of the community management team of 12 areas with 1 representative from each area to give the interview. The questionnaires for the family heads consisted of 2 main parts; general information such as occupations, etc. in the form of checklist. The second part dealt with the data on self reliance community development based on 4P Framework, i.e., People (human resource) development, Place (area) development, Product (economic and income source) development, and Plan (community plan) development in the form of rating scales. Data in the 1st part were calculated to find frequency and percentage while those in the 2nd part were analyzed to find arithmetic mean and SD. Data from the 2nd group of population or the community management team were derived from focus group to find factors influencing successful management together with the in depth interview which were analyzed by descriptive statistics. The results showed that 479 family heads reported that the aspect on the implementation of community plan to self reliance community activities based on Sufficient Economy Philosophy and the 4P was at the average of 3.28 or moderate level. When considering in details, it was found that the 1st aspect was on the area development with the mean of 3.71 or high level followed by human resource development with the mean of 3.44 or moderate level, then, economic and source of income development with the mean of 3.09 or moderate level. The last aspect was community plan development with the mean of 2.89. The results from the small group discussion revealed some factors and guidelines for successful community management as follows: 1) on the People (human resource) development aspect, there was a project to support and develop community leaders. 2) On the aspect of Place (area) development, there was a development on conservative tourism areas. 3) On the aspect of Product (economic and source of income) development, the community leaders promoted the setting of occupational group, saving group, and product processing group. 4) On the aspect of Plan (community plan) development, there was a prioritization through public hearing.