Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Tidal power can play a vital role in integrating as new source of renewable energy to the off-grid power connection in isolated areas, namely Sandwip, in Bangladesh. It can reduce the present energy crisis and improve the social, environmental and economic perspective of Bangladesh. Tidal energy is becoming popular around the world due to its own facilities. The development of any country largely depends on energy sector improvement. Lack of energy sector is because of hampering progress of any country development, and the energy sector will be stable by only depend on sustainable energy sources. Renewable energy having environmental friendly is the only sustainable solution of secure energy system. Bangladesh has a huge potential of tidal power at different locations, but effective measures on this issue have not been considered sincerely. This paper summarizes the current energy scenario, and Bangladesh can produce power approximately 53.19 MW across the country to reduce the growing energy demand utilizing tidal energy as well as it is shown that Sandwip is highly potential place to produce tidal power, which is estimated approximately 16.49 MW by investing only US $10.37 million. Besides this, cost management for tidal power plant has been also discussed.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: There are several types of metal-based devices conceived as dampers for the seismic energy absorber whereby damages to the major structural components could be minimized for both new and existing structures. This paper aimed to develop and evaluate structural performance of slit circular shear panel damper for passive seismic energy protection by inelastic deformation. Structural evaluation was done using commercially available nonlinear FE simulation program. The main parameters considered are: diameter-to-thickness (D/t) ratio and slit length-to-width ratio (l/w). Depending on these parameters three different buckling mode and hysteretic behavior was found: yielding prior to buckling without strength degradation, yielding prior to buckling with strength degradation and yielding with buckling and strength degradation which forms pinching at initial displacement. The susceptible location at which the possible crack is initiated is also identified for selected specimens using rupture index.
Abstract: This research presents the design, fabrication and application of a flavor sensor for an integrated electronic tongue and electronic nose that can allow rapid characterization of multi-component mixtures in a solution. The odor gas and liquid are separated using hydrophobic porous membrane in micro fluidic channel. The sensor uses an array composed of microbeads in micromachined cavities localized on silicon wafer. Sensing occurs via colorimetric and fluorescence changes to receptors and indicator molecules that are attached to termination sites on the polymeric microbeads. As a result, the sensor array system enables simultaneous and near-real-time analyses using small samples and reagent volumes with the capacity to incorporate significant redundancies. One of the key parts of the system is a passive pump driven only by capillary force. The hydrophilic surface of the fluidic structure draws the sample into the sensor array without any moving mechanical parts. Since there is no moving mechanical component in the structure, the size of the fluidic structure can be compact and the fabrication becomes simple when compared to the device including active microfluidic components. These factors should make the proposed system inexpensive to mass-produce, portable and compatible with biomedical applications.
Abstract: The focus of this paper is to compare common approaches for Systems of Innovation (SI) and identify proactive alternatives for driving the innovation. Proactive approaches will also consider short and medium term perspectives with developments in the field of Computer Technology and Artificial Intelligence. Concerning Computer Technology and Large Connected Information Systems, it is reasonable to predict that during current or the next century intelligence and innovation will be separated from the constraints of human driven management. After this happens, humans will be no longer driving the innovation and there is possibility that SI for new intelligent systems will set its own targets and exclude humans. Over long time scale these developments could result in scenario, which will lead to the development of larger, cross galactic (universal) proactive SI and Intelligence.
Abstract: The application of today's semiconductor transistors in high power UHF DVB-T linear amplifiers has evolved significantly by utilizing LDMOS technology. This fact provides engineers with the option to design a single transistor signal amplifier which enables output power and linearity that was unobtainable previously using bipolar junction transistors or later type first generation MOSFETS. The quiescent current stability in terms of thermal variations of the LDMOS guarantees a robust operation in any topology of DVB-T signal amplifiers. Otherwise, progressively uncontrolled heat dissipation enhancement on the LDMOS case can degrade the amplifier’s crucial parameters in regards to the gain, linearity and RF stability, resulting in dysfunctional operation or a total destruction of the unit. This paper presents one more sophisticated approach from the traditional biasing circuits used so far in LDMOS DVB-T amplifiers. It utilizes a microprocessor control technology, providing stability in topologies where IDQ must be perfectly accurate.
Abstract: A vehicle driving with an Adaptive Cruise Control
System (ACC) is usually controlled decentrally, based on the
information of radar systems and in some publications based on
C2X-Communication (CACC) to guarantee stable platoons. In this
paper we present a Model Predictive Control (MPC) design of a
centralized, server-based ACC-System, whereby the vehicular platoon
is modeled and controlled as a whole. It is then proven that the
proposed MPC design guarantees asymptotic stability and hence
string stability of the platoon. The Networked MPC design is
chosen to be able to integrate system constraints optimally as well
as to reduce the effects of communication delay and packet loss.
The performance of the proposed controller is then simulated and
analyzed in an LTE communication scenario using the LTE/EPC
Network Simulator LENA, which is based on the ns-3 network
simulator.
Abstract: In this paper will be discussed two coin´s sides
of crisis scenarios dynamics. On the one's side is negative role
of subsidiary scenario branches in its compactness weakening
by means unduly chaotic atomizing, having many interactive
feedbacks cases, increasing a value of a complexity here.
This negative role reflects the complexity of use cases, weakening
leader compliancy, which brings something as a ´readiness
for controlling capabilities provision´. Leader´s dissatisfaction has
zero compliancy, but factual it is a ´crossbar´ (interface in fact)
between planning and executing use cases. On the other side of this
coin, an advantage of rich scenarios embranchment is possible to see
in a support of response awareness, readiness, preparedness,
adaptability, creativity and flexibility. Here rich scenarios
embranchment contributes to the steadiness and resistance of scenario
mission actors. These all will be presented in live power-points
´Blazons´, modelled via DYVELOP (Dynamic Vector Logistics
of Processes) on the Conference.
Abstract: Overbooking is an approach of selling more goods or services than available capacities because sellers anticipate that some buyers will not show-up or may cancel their bookings. At present, many airlines deploy overbooking strategy in order to deal with the uncertainty of their customers. Particularly, some airlines sell more cargo capacity than what they have available to freight forwarders with beliefs that some of them will cancel later. In this paper, we propose methods to find the optimal overbooking level of volume and weight for air cargo in order to minimize the total cost, containing cost of spoilage and cost of offloaded. Cancellations of volume and weight are jointly random variables with a known joint distribution. Heuristic approaches applying the idea of weight and volume independency is considered to find an appropriate answer to the full problem. Computational experiments are used to explore the performance of approaches presented in this paper, as compared to a naïve method under different scenarios.
Abstract: Vehicular Ad hoc Network (VANET) is a special case of Mobile Ad hoc Network (MANET) used to establish communications and exchange information among nearby vehicles and between vehicles and nearby fixed infrastructure. VANET is seen as a promising technology used to provide safety, efficiency, assistance and comfort to the road users. Routing is an important issue in Vehicular Ad Hoc Network to find and maintain communication between vehicles due to the highly dynamic topology, frequently disconnected network and mobility constraints.
This paper evaluates the performance of two most popular proactive routing protocols OLSR and DSDV in real city traffic scenario on the basis of three metrics namely Packet delivery ratio, throughput and average end to end delay by varying vehicles density and transmission range.
Abstract: Microalgae due to the ability to accumulate high levels of practically valuable polyunsaturated fatty acids attract attention as a promising raw material for commercial products. The features of the growth processes of cells green protococcal microalgae Oocystis rhomboideus, Scenedesmus obliquus, Dictyochlorella globosa at cultivation in different nutritional mediums were determined. For the rapid accumulation of biomass, combined with high productivity of total lipids fraction yield recommended to use the Fitzgerald medium (Scenodesmus obliquus, Oocystis rhomboideus) and/or Bold medium (Dictyochlorella globosa). Productivity of lipids decreased in sequence Dictyochlorella globosa > Scenodesmus obliquus > Oocystis rhomboideus. The bulk of fatty acids fraction of the total lipids is unsaturated fatty acids, which accounts for 70 to 83% of the total number of fatty acids. The share of monoenic acids accounts from 18 to 34%, while the share of unsaturated fatty acids - from 44 to 62% of the total number of unsaturated fatty acids fraction. Among the unsaturated acids dominate α-linolenic acid (C18:3n-3), hexadecatetraenic acid (C16:4) and linoleic acid (C18:2).
Abstract: Polymeric materials have become an integral part of every aspect of today's industry. They have wide applications, inter alia, in areas such as medicine, food industry and agriculture. In agriculture, for example, they are used for the production of pots, irrigation systems and for soil mulching. The aim of this study was the attempt to produce a biodecomposable agricultural mat, by coating cotton fabric with a blend of carboxylated styrene-butadiene latex (LBSK) containing the enzymatic hydrolyzate of keratin from cattle hair, which would serve as a material for mulching.
The production of such material allows the beneficial management of burdensome tannery waste constituted by keratin from cattle hair and at the same time, the production of agricultural mats that much faster undergo decomposition than commonly used polyethylene mats.
Abstract: The purpose of the study was to examine the
relationships between objectively measured physical activity levels
(PALs), enjoyment of physical activity (EPA), and body mass index
(BMI) among adolescents. A total of 188 12-14-year-old Bruneian
secondary school adolescents (88 boys and 100 girls) voluntarily took
part in this study. Subjects wore the RT3 accelerometer for seven
consecutive days in order to measure their PALs. Times of students’
engagement in total (TPA), light (LPA), moderate (MPV), and
vigorous PA (VPA) were obtained from the accelerometer. Their
BMIs were calculated from their body height and weight. Physical
Activity Enjoyment Scale (PACES) was administrated to obtain their
EPA levels. Four key enjoyment factors including fun factors,
positive perceptions, unexciting in doing activities, and negative
perceptions were identified. Subjects’ social economic status (SES)
was provided by school administration. Results show that all the
adolescents did not meet the recommended PA guidelines even
though boys were engaged in more MVPA than girls. No
relationships were found between BMI and all PALs in both boys and
girls. BMI was significantly related to the PACES scores (r = -.22, p
= 0.01), fun factors (r = -.20, p = 0.05) and positive perceptions (r =-
.21, p < 0.05). The PACES scores were significantly related to LPA
(r = .18, p = 0.01) but not related to MVPA (r = .04, p > 0.05). After
controlling for age and SES, BMI was only significantly related to
the PACES scores in girls (r = -.27, p < .01) but boys (r = -.06, p >
0.05). Fun factors were significantly related to LPA and MVPA (p
Abstract: Endophytic microorganisms are presented in plants of different families growing in the foothills and piedmont plains of Trans-Ili Alatau. It was found that the maximum number of endophytic micromycetes is typical to the Fabaceae family. The number of microscopic fungi in the roots reached (145.9±5.9)×103 CFU/g of plant tissue; yeasts - (79.8±3.5)×102 CFU/g of plant tissue. Basically, endophytic microscopic fungi are typical for underground parts of plants. In contrast, yeasts more infected aboveground parts of plants. Small amount of micromycetes is typical to inflorescence and fruits. Antagonistic activity of selected micromycetes against Fusarium graminearum, Cladosporium sp., Phytophtora infestans and Botrytis cinerea phytopathogens was detected. Strains with a broad, narrow and limited range of action were identified. For further investigations Rh2 and T7 strains were selected, they are characterized by a broad spectrum of fungicidal activity and they formed the large inhibition zones against phytopathogens. Active antagonists are attributed to the Rhodotorula mucilaginosa and Beauveria bassiana species.
Abstract: Image matching methods play a key role in deciding correspondence between two image scenes. This paper presents a method for the matching of digital images using mathematical morphology. The proposed method has been applied to real life images. The matching process has shown successful and promising results.
Abstract: The preparation of Cu nanoparticles (NPs) through the reduction of copper ions by sodium borohydride in the presence of sodium polyacrylate with a molecular weight of 1200 is reported. Cu NPs were synthesized at a concentration of copper salt equal to 2.5, 5, and 10 mM, and at a molar ratio of copper ions and monomeric unit of polyacrylate equal to 1:2. The as-prepared Cu NPs have diameters of about 2.5–3 nm for copper concentrations of 2.5 and 5 mM, and 6 nm for copper concentration of 10 mM. Depending on the copper salt concentration and concentration of additionally added polyacrylate to Cu particle dispersion, primarily formed NPs grow through the process of aggregation and/or coalescence into clusters and/or particles with a diameter between 20–100 nm. The amount of additionally added sodium polyacrylate influences the stability of Cu particles against air oxidation. The catalytic efficiency of the prepared Cu particles for the reduction of 4-nitrophenol is discussed.
Abstract: One of the major thrusts of the Bus Rapid Transit System is to reduce the commuter’s dependency on private vehicles and increase the shares of public transport to make urban transportation system environmentally sustainable. In this study, commuter mode choice analysis is performed that examines behavioral responses to the proposed Bus Rapid Transit System (BRTS) in Surat, with estimation of the probable shift from private mode to public mode. Further, evaluation of the BRTS scenarios, using Surat’s transportation ecological footprint was done. A multi-modal simulation model was developed in Biogeme environment to explicitly consider private users behaviors and non-linear environmental impact. The data of the different factors (variables) and its impact that might cause modal shift of private mode users to proposed BRTS were collected through home-interview survey using revealed and stated preference approach. A multi modal logit model of mode-choice was then calibrated using the collected data and validated using proposed sample. From this study, a set of perception factors, with reliable and predictable data base, to explain the variation in modal shift behaviour and their impact on Surat’s ecological environment has been identified. A case study of the proposed BRTS connecting the Surat Industrial Hub to the coastal area is provided to illustrate the approach.