Abstract: Vertical slotted walls can be used as permeable
breakwaters to provide economical and environmental protection
from undesirable waves and currents inside the port. The permeable
breakwaters are partially protection and have been suggested to
overcome the environmental disadvantages of fully protection
breakwaters. For regular waves a semi-analytical model is based on
an eigenfunction expansion method and utilizes a boundary condition
at the surface of each wall are developed to detect the energy
dissipation through the slots. Extensive laboratory tests are carried
out to validate the semi-analytic models. The structure of the physical
model contains two walls and it consists of impermeable upper and
lower part, where the draft is based a decimal multiple of the total
depth. The middle part is permeable with a porosity of 50%. The
second barrier is located at a distant of 0.5, 1, 1.5 and 2 times of the
water depth from the first one. A comparison of the theoretical results
with previous studies and experimental measurements of the present
study show a good agreement and that, the semi-analytical model is
able to adequately reproduce most the important features of the
experiment.
Abstract: The rapid development and growth of technology has changed the method of obtaining information for educators and learners. Technology has created a new world of collaboration and communication among people. Incorporating new technology into the teaching process can enhance learning outcomes. Billions of individuals across the world are now connected together, and are cooperating and contributing their knowledge and intelligence. Time is no longer wasted in waiting until the teacher is ready to share information as learners can go online and get it immediatelt.
The objectives of this paper are to understand the reasons why changes in teaching and learning methods are necessary, to find ways of improving them, and to investigate the challenges that present themselves in the adoption of new ICT tools in higher education institutes.
To achieve these objectives two primary research methods were used: questionnaires, which were distributed among students at higher educational institutes and multiple interviews with faculty members (teachers) from different colleges and universities, which were conducted to find out why teaching and learning methodology should change.
The findings show that both learners and educators agree that educational technology plays a significant role in enhancing instructors’ teaching style and students’ overall learning experience; however, time constraints, privacy issues, and not being provided with enough up-to-date technology do create some challenges.
Abstract: As an emerging business model, cloud computing has been initiated to satisfy the need of organizations and to push Information Technology as a utility. The shift to the cloud has changed the way Information Technology departments are managed traditionally and has raised many concerns for both, public and private sectors.
The purpose of this study is to investigate the possibility of cloud computing services replacing services provided traditionally by IT departments. Therefore, it aims to 1) explore whether organizations in Oman are ready to move to the cloud; 2) identify the deciding factors leading to the adoption or rejection of cloud computing services in Oman; and 3) provide two case studies, one for a successful Cloud provider and another for a successful adopter.
This paper is based on multiple research methods including conducting a set of interviews with cloud service providers and current cloud users in Oman; and collecting data using questionnaires from experts in the field and potential users of cloud services.
Despite the limitation of bandwidth capacity and Internet coverage offered in Oman that create a challenge in adopting the cloud, it was found that many information technology professionals are encouraged to move to the cloud while few are resistant to change.
The recent launch of a new Omani cloud service provider and the entrance of other international cloud service providers in the Omani market make this research extremely valuable as it aims to provide real-life experience as well as two case studies on the successful provision of cloud services and the successful adoption of these services.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The process in which the complementary information from multiple images is integrated to provide composite image that contains more information than the original input images is called image fusion. Medical image fusion provides useful information from multimodality medical images that provides additional information to the doctor for diagnosis of diseases in a better way. This paper represents the wavelet based medical image fusion algorithm on different multimodality medical images. In order to fuse the medical images, images are decomposed using Redundant Wavelet Transform (RWT). The high frequency coefficients are convolved with morphological operator followed by the maximum-selection (MS) rule. The low frequency coefficients are processed by MS rule. The reconstructed image is obtained by inverse RWT. The quantitative measures which includes Mean, Standard Deviation, Average Gradient, Spatial frequency, Edge based Similarity Measures are considered for evaluating the fused images. The performance of this proposed method is compared with Pixel averaging, PCA, and DWT fusion methods. When compared with conventional methods, the proposed framework provides better performance for analysis of multimodality medical images.
Abstract: Object detection using Wavelet Neural Network (WNN) plays a major contribution in the analysis of image processing. Existing cluster-based algorithm for co-saliency object detection performs the work on the multiple images. The co-saliency detection results are not desirable to handle the multi scale image objects in WNN. Existing Super Resolution (SR) scheme for landmark images identifies the corresponding regions in the images and reduces the mismatching rate. But the Structure-aware matching criterion is not paying attention to detect multiple regions in SR images and fail to enhance the result percentage of object detection. To detect the objects in the high-resolution remote sensing images, Tagged Grid Matching (TGM) technique is proposed in this paper. TGM technique consists of the three main components such as object determination, object searching and object verification in WNN. Initially, object determination in TGM technique specifies the position and size of objects in the current image. The specification of the position and size using the hierarchical grid easily determines the multiple objects. Second component, object searching in TGM technique is carried out using the cross-point searching. The cross out searching point of the objects is selected to faster the searching process and reduces the detection time. Final component performs the object verification process in TGM technique for identifying (i.e.,) detecting the dissimilarity of objects in the current frame. The verification process matches the search result grid points with the stored grid points to easily detect the objects using the Gabor wavelet Transform. The implementation of TGM technique offers a significant improvement on the multi-object detection rate, processing time, precision factor and detection accuracy level.
Abstract: Traditional Wireless Sensor Networks (WSNs) generally use static sinks to collect data from the sensor nodes via multiple forwarding. Therefore, network suffers with some problems like long message relay time, bottle neck problem which reduces the performance of the network.
Many approaches have been proposed to prevent this problem with the help of mobile sink to collect the data from the sensor nodes, but these approaches still suffer from the buffer overflow problem due to limited memory size of sensor nodes. This paper proposes an energy efficient scheme for data gathering which overcomes the buffer overflow problem. The proposed scheme creates virtual grid structure of heterogeneous nodes. Scheme has been designed for sensor nodes having variable sensing rate. Every node finds out its buffer overflow time and on the basis of this cluster heads are elected. A controlled traversing approach is used by the proposed scheme in order to transmit data to sink. The effectiveness of the proposed scheme is verified by simulation.
Abstract: Hand grip strength has been utilized as an indicator to evaluate the motor ability of hands, responsible for performing multiple body functions. It is, however, difficult to evaluate other factors (other than hand muscular strength) utilizing the hand grip strength only. In this study, we analyzed the motor ability of hands using EMG and the hand grip strength, simultaneously in order to evaluate concentration, muscular strength reaction time, instantaneous muscular strength change, and agility in response to visual reaction. In results, the average time (and their standard deviations) of muscular strength reaction EMG signal and hand grip strength was found to be 209.6 ± 56.2 ms and 354.3 ± 54.6 ms, respectively. In addition, the onset time which represents acceleration time to reach 90% of maximum hand grip strength, was 382.9 ± 129.9 ms.
Abstract: This research paper aimed to find out how was the ethical climate in an organization and job performance satisfaction of employees affected employees’ engagement and commitment by using the case study of PTT Exploration and Production Public Company Limited, Thailand. The population of this research was 4,383 Thai employees of PTTEP, Thailand. From a total of 420 questionnaires sent out, 345 respondents replied. The statistics utilized was mean score and Multiple Regression Analysis. The findings revealed that the respondents had opinion towards ethical climate of their organization, job performance satisfaction and organization engagement and commitment at a high level. The test of hypothesis disclosed the determinant attributes of job performance satisfaction that affected the respondents’ overall level of organization engagement and commitment. The set of these determinant attributes consisted of employees’ responsibilities for duties, organization’s policies and practice, relationship with organization’s commanders, work security and stability, job description, career path and relationship with colleagues. These variables were able to predict the employees’ organization engagement and commitment at 50.6 percent.
Abstract: This study was aimed to investigate the effect of
various organic supplements on growth and development of
Dendrobium discolor’s protocorms and seedlings growth of
Dendrobium Judy Rutz. Protocorms of Dendrobium discolor with 2.0
cm. in diameter and seedlings of Dendrobium Judy Rutz at the same
size (0.5 cm. height) were sub-cultured on Hyponex medium
supplemented with cow milk (CM), soy milk (SM), potato extract
(PE) and peptone (P) for 2 months. The protocorms were developed
to seedlings in all treatments after cultured for 2 months. However,
the best results were found on Hyponex medium supplemented with
P was the best in which the maximum fresh and dry weight and
maximum shoot height were obtained in this treatment statistically
different (p ≤ 0.05) to other treatments. Moreover, Hyponex medium
supplemented with P also stimulated the maximum mean number of
5.7 shoots per explant which also showed statistically different (p ≤
0.05) when compared to other treatments. The results of growth of
Dendrobium Judy Rutz seedlings indicated the medium
supplemented with 100 mL/L PE enhanced the maximum fresh and
dry weigh per explants with significantly different (p ≤ 0.05) in fresh
weight from other treatments including the control medium without
any organic supplementation. However, the dry weight was not
significantly different (p ≤ 0.05) from medium supplemented with
SM and P. There was multiple shoots induction in all media with or
without organic supplementation ranging from 2.6 to 3 shoots per
explants. The maximum shoot height was also obtained in the
seedlings cultured on medium supplemented with PE while the
longest root length was found in medium supplemented with SM.
Abstract: The purpose of this research was to study the influence of accountants’ potential performance on their working process, a case study of Government Savings Banks in the northeast of Thailand. The independent variables included accounting knowledge, accounting skill, accounting value, accounting ethics, and accounting attitude, while the dependent variable included the success of the working process. A total of 155 accountants working for Government Savings Banks were selected by random sampling. A questionnaire was used as a tool for collecting data. Descriptive statistics in this research included percentage, mean, and multiple regression analyses.
The findings revealed that the majority of accountants were female with an age between 35-40 years old. Most of the respondents had an undergraduate degree with ten years of experience. Moreover, the factors of accounting knowledge, accounting skill, accounting a value and accounting ethics and accounting attitude were rated at a high level. The findings from regression analysis of observation data revealed a causal relationship in that the observation data could explain at least 51 percent of the success in the accountants’ working process.
Abstract: As widely accepted, didactic multiple-choice tests are referred as a tool providing feedback easily and quickly. Despite the final test scores are corrected by a special formula and number of high plausibility distractors is taken into consideration, the results may be influenced by the random choice. The survey was held in three academic years at the Faculty of Informatics and Management, University of Hradec Kralove, Czech Republic, where the multiple-choice test scores were compared to the open-answer ones. The research sample included 567 respondents. The collected data were processed by the NCSS2007 statistic software by the method of frequency and multiple regression analysis and presented in the form of figures and tables. The results proved statistically significant differences in test scores in academic years 2 and 3, and were discussed from the point of the credit system and conditions for teaching/learning English in the Czech education system.
Abstract: In this increasingly visual world, how can we best decipher and understand the many ways that our everyday lives are organized around looking practices and the many images we encounter each day? Indeed, how we interact with and interpret visual images is a basic component of human life. Today, however, we are living in one of the most artificial visual and image-saturated cultures in human history, which makes understanding the complex construction and multiple social functions of visual imagery more important than ever before. Themes regarding our experience of a visually pervasive mediated culture, here, termed visual spectacle.
Abstract: The objective of this research was to study the
influence of Integrated Marketing Communication on Buying
Decision of Consumers in Bangkok. A total of 397 respondents were
collected from customers who drive in Bangkok. A questionnaire was
utilized as a tool to collect data. Statistics utilized in this research
included frequency, percentage, mean, standard deviation, and
multiple regression analysis. Data were analyzed by using Statistical
Package for the Social Sciences.
The findings revealed that the majority of respondents were male
with the age between 25-34 years old, hold undergraduate degree,
married and stay together. The average income of respondents was
between 10,001-20,000 baht. In terms of occupation, the majority
worked for private companies. The effect to the Buying Decision of
Consumers in Bangkok to including sale promotion with the low
interest and discount for an installment, selling by introducing and
gave product information through sales persons, public relation by
website, direct marketing by annual motor show and advertisement
by television media.
Abstract: This study examined the predictive effects of moral competence, prosocial norms and positive behavior recognition on school misbehavior among Chinese junior secondary school students. Results of multiple regression analysis showed that students were more likely to misbehave in school when they had lower levels of moral competence and prosocial norms, and when they perceived their positive behavior being less likely recognized. Practical implications were discussed on how to guide students to make the right choices to behave appropriately in school. Implications for future research were also discussed.
Abstract: This research paper aimed to identify determinants of airline service quality on passengers’ repeated purchase of service. The population of this study was Thai passengers flying domestic flights with Thai Airways, making a total of 300 samples. These 300 samples participated in this research by answering a collection of questions by means of a questionnaire. An analysis of means score and multiple regression revealed that perceived service quality for tangible elements, reliability, responsiveness, assurance and empathy had determined repeated purchase of flight service of the passengers at a high level. Moreover, reliability and responsiveness factors could predict the passengers’ repeated purchase of flight service at the percentage of 30.6. The findings gave a signal that Thai Airways may consider a development of route network and fleet strategy as well as an establishment of aircraft and seat qualification to meet passengers’ needs and requirements. Passengers’ level of satisfaction could also be maximized by offering service value through various kinds of special deals and programs, whereas value- added pricing strategy should be considered in order to differentiate from and beat other leading airline competitors.
Abstract: In the frame of this work, we present an optical multicasting approach based on optical code-words. Our approach associates, in the edge node, an optical code-word to a group multicast address. In the core node, a set of tunable decoders are used to send a traffic data to multiple destinations based on the received code-word. The use of code-words, which correspond to the combination of an input port and a set of output ports, allows the implementation of an optical switching matrix. At the reception of a burst, it will be delayed in an optical memory. And, the received optical code-word is split to a set of tunable optical decoders. When it matches a configured code-word, the delayed burst is switched to a set of output ports.
Abstract: In the frame of this work, we present an optical multicasting approach based on optical code-words. Our approach associates, in the edge node, an optical code-word to a group multicast address. In the core node, a set of tunable decoders are used to send a traffic data to multiple destinations based on the received code-word. The use of code-words, which correspond to the combination of an input port and a set of output ports, allows the implementation of an optical switching matrix. At the reception of a burst, it will be delayed in an optical memory. And, the received optical code-word is split to a set of tunable optical decoders. When it matches a configured code-word, the delayed burst is switched to a set of output ports.
Abstract: This paper describes a node pair selection scheme
in relay-aided multiple source multiple destination communication
system based on stable marriage problem. A general case is assumed
in which all of source, relay and destination nodes are equipped
with multiantenna and carry out multistream transmission. Based
on several metrics introduced from inter-node channel condition,
the preference order is determined about all source-relay and
relay-destination relations, and then the node pairs are determined
using Gale-Shapley algorithm. The computer simulations show
that the effectiveness of node pair selection is larger in multihop
communication. Some additional aspects which are different from
relay-less case are also investigated.