Abstract: The objective of the study was to select the survival of
probiotic strains when exposed to acidic and bile salts condition. Four
probiotic strains Lactobacillus casei subsp. rhamnosus TISTR 047,
Lactobacillus casei TISTR 1500, Lactobacillus acidophilus TISTR
1338 and Lactobacillus plantarum TISTR 1465 were cultured in
MRS broth and incubated at 35ºC for 15 hours before being inoculated
into acidic condition 5 M HCl, pH 2 for 2 hours and bile salt 0.3%,
pH 5.8 for 8 hour. The survived probiotics were counted in MRS agar.
Among four stains, Lactobacillus casei subsp. rhamnosus TISTR 047
was the highest tolerance specie. Lactobacillus casei subsp.
rhamnosus TISTR 047 reduced 6.74±0.07 log CFU/ml after growing
in acid and 5.52±0.05 log CFU/ml after growing in bile salt. Then,
double emulsion of microorganisms was chosen to encapsulate before
spray drying. Spray drying was done with the inlet temperature 170ºC
and outlet temperature 80ºC. The results showed that the survival of
encapsulated Lactobacillus casei subsp. rhamnosus TISTR 047 after
spray drying decreased from 9.63 ± 0.32 to 8.31 ± 0.11 log CFU/ml
comparing with non-encapsulated, 9.63 ± 0.32 to 4.06 ± 0.08 log
CFU/ml. Therefore, Lactobacillus casei subsp. rhamnosus TISTR 047
would be able to survive in gastrointestinal and spray drying condition.
Abstract: A simple, accurate and precise direct spectrophotometric method has been developed for the determination of cefixime in tablets and capsules. The method is based on the reaction of cefixime with a mixture of potassium iodide and potassium iodate to form yellow coloured product in ethanol-distilled water medium at room temperature which absorbed maximally at 352 nm. The factors affecting the reaction product were carefully studied and optimized. The validation parameters based on International Conference on Harmonisation (ICH, USA) guidelines were followed. The effect of common excipients used as additives has been tested and the tolerance limit was calculated for the determination of cefixime. Beer’s law is obeyed in the concentration range of 4 – 24 ug mL-1 with apparent molar absorptivity of 1.52 × 104 L mol-1cm-1 and Sandell’s sensitivity of 0.033 ug/cm2/ 0.001 absorbance unit. The limits of detection and quantitation for the proposed method are 0.32 and 1.06 ug mL-1, respectively. The proposed method has been successfully applied for the determination of cefixime in pharmaceutical formulations. The results obtained by the proposed method were statistically compared with the reference method using t- and F- values and found no significant difference between the two methods. The proposed method can be used as an alternate method for routine quality control analysis of cefixime in pharmaceutical formulations.
Abstract: The paper presents the results of clusterization by
Kohonen self-organizing maps (SOM) applied for analysis of array of
Raman spectra of multi-component solutions of inorganic salts, for
determination of types of salts present in the solution. It is
demonstrated that use of SOM is a promising method for solution of
clusterization and classification problems in spectroscopy of multicomponent
objects, as attributing a pattern to some cluster may be
used for recognition of component composition of the object.
Abstract: From an organizational perspective, leaders are a
variation of the same talent pool in that they all score a larger than
average value on the bell curve that maps leadership behaviors and
characteristics, namely competence, vision, communication,
confidence, cultural sensibility, stewardship, empowerment,
authenticity, reinforcement, and creativity. The question that remains
unanswered and essentially unresolved is how to explain the irony
that leaders are so much alike yet their organizations diverge so
noticeably in their ability to innovate. Leadership intersects with
innovation at the point where human interactions get exceedingly
complex and where certain paradoxical forces cohabit: conflict with
conciliation, sovereignty with interdependence, and imagination with
realism. Rather than accepting that leadership is without context, we
argue that leaders are specialists of their domain and that those
effective at leading for innovation are distinct within the broader pool
of leaders. Keeping in view the extensive literature on leadership and
innovation, we carried out a quantitative study with data collected
over a five-year period involving 240 participants from across five
dissimilar companies based in the United States. We found that while
innovation and leadership are, in general, strongly interrelated (r =
.89, p = 0.0), there are five qualities that set leaders apart on
innovation. These qualities include a large radius of trust, a restless
curiosity with a low need for acceptance, an honest sense of self and
other, a sense for knowledge and creativity as the yin and yang of
innovation, and an ability to use multiple senses in the engagement
with followers. When these particular behaviors and characteristics
are present in leaders, organizations out-innovate their rivals by a
margin of 29.3 per cent to gain an unassailable edge in a business
environment that is regularly disruptive. A strategic outcome of this
study is a psychometric scale named iLeadership, proposed with the
underlying evidence, limitations, and potential for leadership and
innovation in organizations.c
Abstract: This paper presents the voltage problem location
classification using performance of Least Squares Support Vector
Machine (LS-SVM) and Learning Vector Quantization (LVQ) in
electrical power system for proper voltage problem location
implemented by IEEE 39 bus New- England. The data was collected
from the time domain simulation by using Power System Analysis
Toolbox (PSAT). Outputs from simulation data such as voltage, phase
angle, real power and reactive power were taken as input to estimate
voltage stability at particular buses based on Power Transfer Stability
Index (PTSI).The simulation data was carried out on the IEEE 39 bus
test system by considering load bus increased on the system. To verify
of the proposed LS-SVM its performance was compared to Learning
Vector Quantization (LVQ). The results showed that LS-SVM is faster
and better as compared to LVQ. The results also demonstrated that the
LS-SVM was estimated by 0% misclassification whereas LVQ had
7.69% misclassification.
Abstract: The emergence of the Semantic Web technology
increases day by day due to the rapid growth of multiple web pages.
Many standard formats are available to store the semantic web data.
The most popular format is the Resource Description Framework
(RDF). Querying large RDF graphs becomes a tedious procedure
with a vast increase in the amount of data. The problem of query
optimization becomes an issue in querying large RDF graphs.
Choosing the best query plan reduces the amount of query execution
time. To address this problem, nature inspired algorithms can be used
as an alternative to the traditional query optimization techniques. In
this research, the optimal query plan is generated by the proposed
SAPSO algorithm which is a hybrid of Simulated Annealing (SA)
and Particle Swarm Optimization (PSO) algorithms. The proposed
SAPSO algorithm has the ability to find the local optimistic result
and it avoids the problem of local minimum. Experiments were
performed on different datasets by changing the number of predicates
and the amount of data. The proposed algorithm gives improved
results compared to existing algorithms in terms of query execution
time.
Abstract: This paper presents the electrical effect of two neighboring distribution substation during the construction phase. The size of auxiliary grounding grid have an effect on entire grounding system. The bigger the size of auxiliary grounding grid, the lower the GPR and maximum touch voltage, with the exception that when the two grids are unconnected, i.e. the bigger the size of auxiliary grounding grid, the higher the maximum step voltage. The results in this paper could be served as design guideline of grounding system, and perhaps remedy of some troublesome grounding grids in power distribution’s system. Modeling and simulation is carried out on the Current Distribution Electromagnetic interference Grounding and Soil structure (CDEGS) program. The simulation results exhibit the design and analysis of power system grounding and perhaps could be set as a standard in grounding system design and modification in distribution substations.
Abstract: The purpose of this work is to optimize a Switched Reluctance Motor (SRM) for an automotive application, specifically for a fully electric car. A new optimization approach is proposed. This unique approach transforms automotive customer requirements into an optimization problem, based on sound knowledge of a SRM theory. The approach combines an analytical and a finite element analysis of the motor to quantify static nonlinear and dynamic performance parameters, as phase currents and motor torque maps, an output power and power losses in order to find the optimal motor as close to the reality as possible, within reasonable time. The new approach yields the optimal motor which is competitive with other types of already proposed motors for automotive applications. This distinctive approach can also be used to optimize other types of electrical motors, when parts specifically related to the SRM are adjusted accordingly.
Abstract: The use of low quality concrete has been identified as one of the main causes of the incessant collapse of buildings in Nigeria. Emphasis has been on the use of poor quality aggregates, poor workmanship and the use of lean concrete mix with low cement quantity as the reasons for the low quality of concrete used for building construction in Nigeria. Surveys conducted revealed that in the construction of most privately owned buildings where concrete trial mixes and concrete compressive strength quality assurance tests are not conducted, concretes used for building constructions are produced using the 1:2:4 mix ratio irrespective of the cement grade/strength class. In this paper, the possible role of the use of inappropriate cement grade/strength class as a cause of the incessant collapse of building in Nigeria is investigated. Investigation revealed that the compressive strengths of concrete cubes produced with Portland-limestone cement grade 32.5 using 1:2:4 and 1:1.5:3 mix ratios are less than the 25MPa and 30MPa cube strengths generally recommended for building superstructures and foundations respectively. Conversely, the compressive strengths of concrete cubes produced with Portland-limestone cement grade 42.5 using 1:2:4 and 1:1.5:3 mix ratios exceed the 25MPa and 30MPa generally recommended for building superstructures and foundations respectively. Thus, it can be concluded that the use of inappropriate cement grade (Portland-limestone cement grade 32.5), particularly for the construction of building foundations is a potential cause of the incessant collapse of buildings in Nigeria. It is recommended that the Standards Organisation of Nigeria should embark on creating awareness for Nigerians, particularly, the home owners and the roadside craftsmen that Portland-limestone cement grade 32.5 should not be used for the construction of building load-carrying members, particularly, building foundations in order to reduce the incessant incidence of collapsed building.
Abstract: This paper presents the findings of an experimental investigation of important machining parameters for the horizontal boring tool modified to mouth with a horizontal lathe machine to bore an overlength workpiece. In order to verify a usability of a modified tool, design of experiment based on Taguchi method is performed. The parameters investigated are spindle speed, feed rate, depth of cut and length of workpiece. Taguchi L9 orthogonal array is selected for four factors three level parameters in order to minimize surface roughness (Ra and Rz) of S45C steel tubes. Signal to noise ratio analysis and analysis of variance (ANOVA) is performed to study an effect of said parameters and to optimize the machine setting for best surface finish. The controlled factors with most effect are depth of cut, spindle speed, length of workpiece, and feed rate in order. The confirmation test is performed to test the optimal setting obtained from Taguchi method and the result is satisfactory.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: In recent years, geographic information systems (GIS)
and remote sensing using has increased to estimate runoff catchment.
In this research, runoff curve number maps for captive catchment of
Tehran by helping GIS and also remote sensing which based on
factors such as vegetation, lands using, group of soil hydrology and
hydrological conditions were obtained. Runoff curve numbers map
was obtained by combining these maps in ARC GIS and SCS table.
To evaluate the accuracy of the results, the maximum flow rate of
flood which was obtained from curve numbers, was compared with
the measured maximum flood rate at the watershed outlet and
correctness of curve numbers were approved.
Abstract: This paper proposes a GLMM with spatial and
temporal effects for malaria data in Thailand. A Bayesian method is
used for parameter estimation via Gibbs sampling MCMC. A
conditional autoregressive (CAR) model is assumed to present the
spatial effects. The temporal correlation is presented through the
covariance matrix of the random effects. The malaria quarterly data
have been extracted from the Bureau of Epidemiology, Ministry of
Public Health of Thailand. The factors considered are rainfall and
temperature. The result shows that rainfall and temperature are
positively related to the malaria morbidity rate. The posterior means
of the estimated morbidity rates are used to construct the malaria
maps. The top 5 highest morbidity rates (per 100,000 population) are
in Trat (Q3, 111.70), Chiang Mai (Q3, 104.70), Narathiwat (Q4,
97.69), Chiang Mai (Q2, 88.51), and Chanthaburi (Q3, 86.82).
According to the DIC criterion, the proposed model has a better
performance than the GLMM with spatial effects but without
temporal terms.
Abstract: Keyboard is the most important equipment for computer tasks. However, improper design of keyboard would cause some symptoms like ulnar and/or radial deviations. The research goal of this study was to investigate the optimal size(s) of keycaps to increase efficiency. As shown in the questionnaire pre-study with 49 participants aged from 20 to 44, the most commonly used keyboards were 101-key standard keyboards. Most of the keycap sizes (W×L) were 1.3×1.5 cm and 1.5×1.5 cm. The fingertip breadths of most participants were 1.2 cm. Therefore, in the main study with 18 participants, a standard keyboard with each set of the 3-sized (1.2×1.4 cm, 1.3×1.5 cm, and 1.5×1.5 cm) keycaps were used to investigate their typing efficiency, respectively. The results revealed that the differences between the operating times for using 1.3×1.5 cm and 1.2×1.4 cm keycaps was insignificant while operating times for using 1.5×1.5cm keycaps were significantly longer than for using 1.2×1.4 cm or 1.3×1.5 cm, respectively. As for typing error rate, there was no significant difference.
Abstract: The approach in analyzing defects on different pipe lines is conducted through Failure Assessment Diagram (FAD). These methods of analyses have further extended in recent years. This approach is used to identify and stress out a solution for the defects which randomly occur with gas pipes such are corrosion defects, gauge defects, and combination of defects where gauge and dents are included. Few of the defects are to be analyzed in this paper where our main focus will be the fracture of cast Iron pipes, elastic-plastic failure and plastic collapse of X52 steel pipes for gas transport. We need to conduct a calculation of probability of the defects in order to predict and avoid such costly defects.
Abstract: The objectives of this research were to develop and find the efficiency of integrated online lessons by investigating the usage of online lessons, the relationship between learners’ background knowledge, and the achievement after learning with online lessons. The sample group in this study consisted of 97 students randomly selected from 121 students registering in 1/2012 at Trimitwittayaram Learning Center. The sample technique employed stratified sample technique of 4 groups according to their proficiency, i.e. high, moderate, low, and non-knowledge. The research instrument included online lessons in integration model on the topic of Java Programming, test after each lesson, the achievement test at the end of the course, and the questionnaires to find learners’ satisfaction. The results showed that the efficiency of online lessons was 90.20/89.18 with the achievement of after learning with the lessons higher than that before the lessons at the statistically significant level of 0.05. Moreover, the background knowledge of the learners on the programming showed the positive relationship with the achievement learning at the statistically significant level at 0.05. Learners with high background knowledge employed less exercises and samples than those with lower background knowledge. While learners with different background in the group of moderate and low did not show the significant difference in employing samples and exercises.
Abstract: By running transactions under the SNAPSHOT isolation
we can achieve a good level of concurrency, specially in databases
with high-intensive read workloads. However, SNAPSHOT is not
immune to all the problems that arise from competing transactions
and therefore no serialization warranty exists. We propose in this
paper a technique to obtain data consistency with SNAPSHOT by using
some special triggers that we named DAEMON TRIGGERS. Besides
keeping the benefits of the SNAPSHOT isolation, the technique is
specially useful for those database systems that do not have an
isolation level that ensures serializability, like Firebird and Oracle. We
describe all the anomalies that might arise when using the SNAPSHOT
isolation and show how to preclude them with DAEMON TRIGGERS.
Based on the methodology presented here, it is also proposed the
creation of a new isolation level: DAEMON SNAPSHOT.
Abstract: A review of the literature on supply chain delivery models which use delivery windows to measure delivery performance is presented. The review herein serves to meet the following objectives: (i) provide a synthesis of previously published literature on supply chain delivery performance models, (ii) provide in one paper a consolidation of research that can serve as a single source to keep researchers up to date with the research developments in supply chain delivery models, and (iii) identify gaps in the modeling of supply chain delivery performance which could stimulate new research agendas.
Abstract: Membrane distillation is an emerging technology which has been used to produce freshwater and purify different types of aqueous mixtures. Qatar is an arid country where almost 100% of its freshwater demand is supplied through the energy-intensive thermal desalination process. The country’s need for water has reached an all-time high which stipulates finding an alternative way to augment freshwater without adding any drastic affect to the environment. The objective of this paper was to investigate the potential of using the industrial low grade waste heat to produce freshwater using membrane distillation. The main part of this work was conducting a heat audit on selected Qatari chemical industries to estimate the amounts of freshwater produced if such industrial waste heat were to be recovered. By the end of this work, the main objective was met and the heat audit conducted on the Qatari chemical industries enabled us to estimate both the amounts of waste heat which can be potentially recovered in addition to the amounts of freshwater which can be produced if such waste heat were to be recovered.
By the end, the heat audit showed that around 605 Mega Watts of waste heat can be recovered from the studied Qatari chemical industries which resulted in a total daily production of 5078.7 cubic meter of freshwater.
This water can be used in a wide variety of applications such as human consumption or industry. The amount of produced freshwater may look small when compared to that produced through thermal desalination plants; however, one must bear in mind that this water comes from waste and can be used to supply water for small cities or remote areas which are not connected to the water grid. The idea of producing freshwater from the two widely-available wastes (thermal rejected brine and waste heat) seems promising as less environmental and economic impacts will be associated with freshwater production which may in the near future augment the conventional way of producing freshwater currently being thermal desalination. This work has shown that low grade waste heat in the chemical industries in Qatar and perhaps the rest of the world can contribute to additional production of freshwater using membrane distillation without significantly adding to the environmental impact.
Abstract: Plant preparations from thyme and garlic have been shown to be effective acaricides against the poultry red mite, Dermanyssus gallinae. In a layer house with a history of D. gallinae problem, mites were detected in the monitoring traps for the first time and number of them was counted. Then, some rows of layer house was sprayed twice using a concentration of 0.21 mg/cm2 thyme essential oil and 0.07 mg/cm2 garlic juice and a similar row was used as an untreated control group. Red mite traps made of cardboard were used to assess the mite density during days 1 and 7 after treatment and always removed after 24 h. the collected mites were counted and the efficacy against all mite stages (larvae, nymphs and adults) was calculated. Results showed that on day 1 and 7 after the administration of garlic extract efficacy rate was 92.05% and 74.62%, respectively. Moreover, efficacy rate on day 1 and 7 was 89.4% and 95.37% when treatment was done with thyme essential oil. It is concluded that using garlic juice to control of D. gallinae is more effective on short time. But thyme essential oil has a long time effect in compare to garlic preparation.