Abstract: Data Grid is a geographically distributed environment that deals with data intensive application in scientific and enterprise computing. Data replication is a common method used to achieve efficient and fault-tolerant data access in Grids. In this paper, a dynamic data replication strategy, called Enhanced Latest Access Largest Weight (ELALW) is proposed. This strategy is an enhanced version of Latest Access Largest Weight strategy. However, replication should be used wisely because the storage capacity of each Grid site is limited. Thus, it is important to design an effective strategy for the replication replacement task. ELALW replaces replicas based on the number of requests in future, the size of the replica, and the number of copies of the file. It also improves access latency by selecting the best replica when various sites hold replicas. The proposed replica selection selects the best replica location from among the many replicas based on response time that can be determined by considering the data transfer time, the storage access latency, the replica requests that waiting in the storage queue and the distance between nodes. Simulation results utilizing the OptorSim show our replication strategy achieve better performance overall than other strategies in terms of job execution time, effective network usage and storage resource usage.
Abstract: This research aimed to study on the efficiency of wastewater treatment by comparing the different aeration times of surface aerators in Suan Sunandha Rajabhat University. In doing so, the operation of surface aerators was divided into 2 groups which included the groups of 8 hours (8-0/opened-closed) and 4 hours (2-2/opened-closed) of aeration time per day. As a result of the study, it was found that the efficiency of wastewater treatment in the forms of DO, BOD, turbidity and NO2- by 8 hours (8-0/opened-closed) and 4 hours (2-2/opened-closed) of aeration time per day of surface aerators was not statistically different [Sig. = .644, .488, .716 and .054 > α (.05)] while the efficiency in the forms of NO3- and P was significantly different at the statistical level of .01 [Sig. = .001 and .000 < α (.01)].
Abstract: In this paper, we employ a directed hypergraph model
to investigate the extent to which environmental variability influences
the set of available biochemical reactions within a living cell.
Such an approach avoids the limitations of the usual complex
network formalism by allowing for the multilateral relationships (i.e.
connections involving more than two nodes) that naturally occur
within many biological processes. More specifically, we extend the
concept of network reciprocity to complex hyper-networks, thus
enabling us to characterise a network in terms of the existence
of mutual hyper-connections, which may be considered a proxy
for metabolic network complexity. To demonstrate these ideas, we
study 115 metabolic hyper-networks of bacteria, each of which
can be classified into one of 6 increasingly varied habitats.
In particular, we found that reciprocity increases significantly
with increased environmental variability, supporting the view that
organism adaptability leads to increased complexities in the resultant
biochemical networks.
Abstract: This paper investigates the natural convection heat transfer performance in a complex-wavy-wall cavity filled with power-law fluid. In performing the simulations, the continuity, Cauchy momentum and energy equations are solved subject to the Boussinesq approximation using a finite volume method. The simulations focus specifically on the effects of the flow behavior index in the power-law model and the Rayleigh number on the flow streamlines, isothermal contours and mean Nusselt number within the cavity. The results show that pseudoplastic fluids have a better heat transfer performance than Newtonian or dilatant fluids. Moreover, it is shown that for Rayleigh numbers greater than Ra=103, the mean Nusselt number has a significantly increase as the flow behavior index is decreased.
Abstract: As a developing country, The Kingdom of Saudi Arabia (KSA) needs to make the best possible use of its workforce for social and economic reasons. The workforce is diverse, calling for appropriate diversity management (DM). The thesis focuses on the banking sector in KSA. To date, there have been no studies on DM in the banking sector in this country. Many organizations have introduced specific policies and programmes to improve the recruitment, inclusion, promotion, and retention of diverse employees, in addition to the legal requirements existing in many countries. However, Western-centric models of DM may not be applicable, at least not in their entirety, in other regions.
The aim of the study is to devise a framework for understanding gender, age and disability DM in the banking sector in KSA in order to enhance DM in this sector. A sample of 24 managers, 2 from each of the 12 banks, was interviewed to obtain their views on DM in the banking sector in KSA. Thematic analysis was used to analyze the data. These themes were used to develop the questionnaire, which was administered to 10 managers in each of the 12 banks. After analysis of these data, and completion of the study, the research will make a theoretical contribution to the knowledge on DM and a practical contribution to the management of diversity in Saudi banks. This paper concerns a work in progress.
Abstract: With the advances in information and communications technology, mobile context-aware applications have become powerful marketing tools. In Apple online store, there are numerous mobile applications (APPs) developed for destination tour. This study investigated the determinants of adoption of context-aware APPs for destination tour services. A model is proposed based on Technology Acceptance Model and privacy concern theory. The model was empirically tested based on a sample of 259 users of a tourism APP published by Kaohsiung Tourism Bureau, Taiwan. The results showed that the fitness of the model is well and, among all the factors, the perceived usefulness and perceived ease of use have the most significant influences on the intention to adopt context-aware destination APPs. Finally, contrary to the findings of previous literature, the effect of privacy concern on the adoption intention of context-aware APP is insignificant.
Abstract: DC-DC converters are widely used as reliable power source for many industrial and military applications, computers and electronic devices. Several control methods were developed for DC-DC converters control mostly with asymptotic convergence. Synergetic control (SC) is a proven robust control approach and will be used here in a so called terminal scheme to achieve finite time convergence. Lyapounov synthesis is adopted to assure controlled system stability. Furthermore particle swarm optimization (PSO) algorithm, based on an integral time absolute of error (ITAE) criterion will be used to optimize controller parameters. Simulation of terminal synergetic control of a DC-DC converter is carried out for different operating conditions and results are compared to classic synergetic control performance, that which demonstrate the effectiveness and feasibility of the proposed control method.
Abstract: Wireless communications have been expanded very fast in recent decades. This technology relies on an extensive network of base stations and antennas, using radio frequency signals to transmit information. Devices that use wireless communication, while offering various services, basically act as sources of non-ionizing electromagnetic fields (EMF). Such devices are permanently present in human vicinity and almost constantly radiate, causing EMF pollution of the environment. This fact has initiated development of modern systems for observation of the EMF pollution, as well as for risk assessment. This paper presents the Serbian electromagnetic field monitoring network – SEMONT, designed for automated, remote and continuous broadband monitoring of EMF in the environment. Measurement results of the SEMONT monitoring at one of the test locations, within the main campus of the University of Novi Sad, are presented and discussed, along with corresponding exposure assessment of the general population, regarding the Serbian legislation.
Abstract: Since women obtained the right to vote in 1893 for the first time in New Zealand, they have tried to participate actively into politics but still the world has a few women in political leadership. The article asks which factors might influence the appearance of women leadership in politics. The article investigates two factors such as political context, personal factors. Countries where economic development is stable and political democracy is consolidated have a tendency of appearance of women political leadership but in less developed and politically unstable countries, women politicians can be in power with their own reasons. For the personal factor, their feminist propensity is studied but there is no relationship between the appearance of women leaders and their feminist propensity.
Abstract: Cloud virtualization technologies are becoming more
and more prevalent, cloud users usually encounter the problem of how
to access to the virtualized remote desktops easily over the web
without requiring the installation of special clients. To resolve this
issue, we took advantage of the HTML5 technology and developed
web-based remote desktop. It permits users to access the terminal
which running in our cloud platform from anywhere. We implemented
a sketch of web interface following the cloud computing concept that
seeks to enable collaboration and communication among users for
high performance computing. Given the development of remote
desktop virtualization, it allows to shift the user’s desktop from the
traditional PC environment to the cloud platform, which is stored on a
remote virtual machine rather than locally. This proposed effort has
the potential to positively provide an efficient, resilience and elastic
environment for online cloud service. This is also made possible by the
low administrative costs as well as relatively inexpensive end-user
terminals and reduced energy expenses.
Abstract: The purpose of this study was to investigate the relationships among leisure motivation, leisure attitude, and health promotion lifestyle. The participants were recruited from a convenience sampling that subjects were at least 55 years of age in Tainan City, Taiwan. Three hundred survey instruments were distributed, and 227 effective instruments were returned, for an effective rate of 75.7%. The collected data were analyzed statistically. The findings of this research were as follows: 1.There is significantly correlated between leisure motivation and leisure attitude. 2. There is significantly correlated between leisure attitude and health promotion lifestyle. 3. There is significantly correlated between leisure motivation and health promotion lifestyle.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: Two new algorithms for nonparametric estimation of errors-in-variables models are proposed. The first algorithm is based on penalized regression spline. The spline is represented as a piecewise-linear function and for each linear portion orthogonal regression is estimated. This algorithm is iterative. The second algorithm involves locally weighted regression estimation. When the independent variable is measured with error such estimation is a complex nonlinear optimization problem. The simulation results have shown the advantage of the second algorithm under the assumption that true smoothing parameters values are known. Nevertheless the use of some indexes of fit to smoothing parameters selection gives the similar results and has an oversmoothing effect.
Abstract: In recent years, many researchers are involved in the
field of fuzzy theory. However, there are still a lot of issues to be
resolved. Especially on topics related to controller design such as the
field of robot, artificial intelligence, and nonlinear systems etc.
Besides fuzzy theory, algorithms in swarm intelligence are also a
popular field for the researchers. In this paper, a concept of utilizing
one of the swarm intelligence method, which is called Bacterial-GA
Foraging, to find the stabilized common P matrix for the fuzzy
controller system is proposed. An example is given in in the paper, as
well.
Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This paper deals with the problem of delay-dependent
stability for neural networks with distributed delays. Some new
sufficient condition are derived by constructing a novel
Lyapunov-Krasovskii functional approach. The criteria are
formulated in terms of a set of linear matrix inequalities, this is
convenient for numerically checking the system stability using the
powerful MATLAB LMI Toolbox. Moreover, in order to show the
stability condition in this paper gives much less conservative results
than those in the literature, numerical examples are considered.
Abstract: Farmers are in need of regular and relevant information relating to new technologies. Production of extension materials has been found to be useful in facilitating the process. Extension materials help to provide information to reach large numbers of farmers quickly and economically. However, as good as extension materials are, previous materials produced are not used by farmers. The reasons for this include lack of involvement of farmers in the production of the extension materials, most of the extension materials are not relevant to the farmers’ environments, the agricultural extension agents lack capacity to prepare the materials, and many extension agents lack commitment. These problems led to this innovative capacity building of extension agents. This innovative approach involves five stages. The first stage is the diagnostic survey of farmers’ environment to collect useful information. The second stage is the development and production of draft extension materials. The third stage is the field testing and evaluation of draft materials by the same famers that were involved at the diagnostic stage. The fourth stage is the revision of the draft extension materials by incorporating suggestions from farmers. The fifth stage is the action plans. This process improves the capacity of agricultural extension agents in the preparation of extension materials and also promotes engagement of farmers and beneficiaries in the process. The process also makes farmers assume some level of ownership of the exercise and the extension materials.
Abstract: The process in which the complementary information from multiple images is integrated to provide composite image that contains more information than the original input images is called image fusion. Medical image fusion provides useful information from multimodality medical images that provides additional information to the doctor for diagnosis of diseases in a better way. This paper represents the wavelet based medical image fusion algorithm on different multimodality medical images. In order to fuse the medical images, images are decomposed using Redundant Wavelet Transform (RWT). The high frequency coefficients are convolved with morphological operator followed by the maximum-selection (MS) rule. The low frequency coefficients are processed by MS rule. The reconstructed image is obtained by inverse RWT. The quantitative measures which includes Mean, Standard Deviation, Average Gradient, Spatial frequency, Edge based Similarity Measures are considered for evaluating the fused images. The performance of this proposed method is compared with Pixel averaging, PCA, and DWT fusion methods. When compared with conventional methods, the proposed framework provides better performance for analysis of multimodality medical images.