Abstract: Background: The high prevalence of obesity in Egypt has a great impact on the health care system, economic and social situation. Evidence suggests that even a moderate amount of weight loss can be useful. Aim of the study: To analyze the effects of lower body positive pressure supported treadmill training, conducted with hypocaloric diet, on body composition of obese children. Methods: Thirty children aged between 8 and 14 years, were randomly assigned into two groups: intervention group (15 children) and control group (15 children). All of them were evaluated using body composition analysis through bioelectric impedance. The following parameters were measured before and after the intervention: body mass, body fat mass, muscle mass, body mass index (BMI), percentage of body fat and basal metabolic rate (BMR). The study group exercised with antigravity treadmill three times a week during 2 months, and participated in a hypocaloric diet program. The control group participated in a hypocaloric diet program only. Results: Both groups showed significant reduction in body mass, body fat mass and BMI. Only study group showed significant reduction in percentage of body fat (p = 0.0.043). Changes in muscle mass and BMR didn't reach statistical significance in both groups. No significant differences were observed between groups except for muscle mass (p = 0.049) and BMR (p = 0.042) favoring study group. Conclusion: Both programs proved effective in the reduction of obesity indicators, but lower body positive pressure supported treadmill training was more effective in improving muscle mass and BMR.
Abstract: Both knowledge economy and sustainable development are considered key dimensions in the policy action lines of many developed and developing countries. In this context, universities and other higher education institutes have a vital role in developing and sustaining wellbeing communities.
In this paper, the authors’ aim is to address the links between the concepts of innovation and entrepreneurial capacity and knowledge economy, and to utilize the approach of intellectual capital development in building a sustainable knowledge economy.
The paper will contribute to two discourses:
Developing a common understanding of the intersection aspects between the three concepts: Knowledge economy, Innovation and entrepreneurial system, and sustainable development.
Paving the road towards developing an integrated multidimensional framework for sustainable knowledge economy.
Abstract: Except for the internal aspects of entrepreneurship (i.e.motivation, opportunity perspective and alertness), there are external aspects that affecting entrepreneurship (i.e. the industrial cluster). By comparing the machinery companies located inside and outside the industrial district, this study aims to explore the cluster effects on the entrepreneurship of companies in Taiwan machinery clusters (TMC). In this study, three factors affecting the entrepreneurship in TMC are conducted as “competition”, “embedded-ness” and “specialized knowledge”. The “competition” in the industrial cluster is defined as the competitive advantages that companies gain in form of demand effects and diversified strategies; the “embedded-ness” refers to the quality of company relations (relational embedded-ness) and ranges (structural embedded-ness) with the industry components (universities, customers and complementary) that affecting knowledge transfer and knowledge generations; the “specialized knowledge” shares theinternal knowledge within industrial clusters. This study finds that when comparing to the companieswhich are outside the cluster, the industrial cluster has positive influence on the entrepreneurship. Additionally, the factor of “relational embedded-ness” has significant impact on the entrepreneurship and affects the adaptation ability of companies in TMC. Finally, the factor of “competition” reveals partial influence on the entrepreneurship.
Abstract: This work presents a comparison study between the state-space and polynomial methods for the design of the robust governor for load frequency control of steam turbine power systems. The robust governor is synthesized using the two approaches and the comparison is extended to include time and frequency domains performance, controller order, and uncertainty representation, weighting filters, optimality and sub-optimality. The obtained results are represented through tables and curves with reasons of similarities and dissimilarities.
Abstract: Tidal power can play a vital role in integrating as new source of renewable energy to the off-grid power connection in isolated areas, namely Sandwip, in Bangladesh. It can reduce the present energy crisis and improve the social, environmental and economic perspective of Bangladesh. Tidal energy is becoming popular around the world due to its own facilities. The development of any country largely depends on energy sector improvement. Lack of energy sector is because of hampering progress of any country development, and the energy sector will be stable by only depend on sustainable energy sources. Renewable energy having environmental friendly is the only sustainable solution of secure energy system. Bangladesh has a huge potential of tidal power at different locations, but effective measures on this issue have not been considered sincerely. This paper summarizes the current energy scenario, and Bangladesh can produce power approximately 53.19 MW across the country to reduce the growing energy demand utilizing tidal energy as well as it is shown that Sandwip is highly potential place to produce tidal power, which is estimated approximately 16.49 MW by investing only US $10.37 million. Besides this, cost management for tidal power plant has been also discussed.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: Japanese society is experiencing an aging population and declining birth rate along with the popularization of higher education, spread of economic globalization, rapid progress in technical innovation, changes in employment conditions, and emergence of a knowledge-based society. Against this background, interest in career education at Japanese universities has increased in recent years. This paper describes how the government has implemented career education policies in Japan, and introduces the cases of two universities that have successfully linked career education to university education in Japan.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The copyrights system is a combination of different elements. The number, content and the correlation of these elements are different for different legal orders. The models of copyrights systems display this system in terms of the interaction of economic and author's moral rights. Monistic and dualistic models are the most popular ones. The article deals with different points of view on the monism and dualism in copyright system. A specific model of the copyright in Switzerland in the XXth century is analyzed. The evolution of a French dualistic model of copyright is shown. The author believes that one should talk not about one, but rather about a number of dualism forms of copyright system.
Abstract: Localization of mobile robots are important tasks for
developing autonomous mobile robots. This paper proposes a method
to estimate positions of a mobile robot using a omnidirectional
camera on the robot. Landmarks for points of references are set
up on a field where the robot works. The omnidirectional camera
which can obtain 360 [deg] around images takes photographs of
these landmarks. The positions of the robots are estimated from
directions of these landmarks that are extracted from the images
by image processing. This method can obtain the robot positions
without accumulative position errors. Accuracy of the estimated
robot positions by the proposed method are evaluated through some
experiments. The results show that it can obtain the positions with
small standard deviations. Therefore the method has possibilities of
more accurate localization by tuning of appropriate offset parameters.
Abstract: Farmers are in need of regular and relevant information relating to new technologies. Production of extension materials has been found to be useful in facilitating the process. Extension materials help to provide information to reach large numbers of farmers quickly and economically. However, as good as extension materials are, previous materials produced are not used by farmers. The reasons for this include lack of involvement of farmers in the production of the extension materials, most of the extension materials are not relevant to the farmers’ environments, the agricultural extension agents lack capacity to prepare the materials, and many extension agents lack commitment. These problems led to this innovative capacity building of extension agents. This innovative approach involves five stages. The first stage is the diagnostic survey of farmers’ environment to collect useful information. The second stage is the development and production of draft extension materials. The third stage is the field testing and evaluation of draft materials by the same famers that were involved at the diagnostic stage. The fourth stage is the revision of the draft extension materials by incorporating suggestions from farmers. The fifth stage is the action plans. This process improves the capacity of agricultural extension agents in the preparation of extension materials and also promotes engagement of farmers and beneficiaries in the process. The process also makes farmers assume some level of ownership of the exercise and the extension materials.
Abstract: A Jet-stream airsail concept takes advantage of aerology
in order to fly without propulsion. Weather phenomena, especially jet
streams, are relatively permanent high winds blowing from west to
east, located at average altitudes and latitudes in both hemispheres.
To continuously extract energy from the jet-stream, the system is
composed of a propelled plane and a wind turbine interconnected by
a cable. This work presents the aerodynamic characteristics and the
behavior of the cable that links the two subsystems and transmits
energy from the turbine to the aircraft. Two ways of solving this
problem are explored: numerically and analytically. After obtaining
the optimal shape of the cross-section of the cable, its behavior
is analyzed as a 2D problem solved numerically and analytically.
Finally, a 3D extension could be considered by adding lateral forces.
The results of this work can be further used in the design process of
the overall system: aircraft-turbine.
Abstract: Small and medium-sized enterprises (SME) are the backbone of central Europe’s economies and have a significant contribution to the gross domestic product. Production planning and scheduling (PPS) is still a crucial element in manufacturing industries of the 21st century even though this area of research is more than a century old. The topic of PPS is well researched especially in the context of large enterprises in the manufacturing industry. However the implementation of PPS methodologies within SME is mostly unobserved. This work analyzes how PPS is implemented in SME with the geographical focus on Switzerland and its vicinity. Based on restricted resources compared to large enterprises, SME have to face different challenges. The real problem areas of selected enterprises in regards of PPS are identified and evaluated. For the identified real-life problem areas of SME clear and detailed recommendations are created, covering concepts and best practices and the efficient usage of PPS. Furthermore the economic and entrepreneurial value for companies is lined out and why the implementation of the introduced recommendations is advised.
Abstract: To measure or asses any government’s efficiency we need to measure the performance of this government in regards to the quality of the service it provides. Using a technological platform in service provision became a trend and a public demand. It is also a public need to make sure these services are aligned to values and to the whole government’s strategy, vision and goals as well. Providing services using technology tools and channels can enhance the internal business process and also help establish many essential values to government services like transparency and excellence, since in order to establish e-services many standards and policies must be put in place to enable the handing over of decision making to a mature system oriented mechanism. There was no doubt that the Sultanate of Oman wanted to enhance its services and move it towards automation and establishes a smart government as well as links its services to life events. Measuring government efficiency is very essential in achieving social security and economic growth, since it can provide a clear dashboard of all projects and improvements. Based on this data we can improve the strategies and align the country goals to them.
Abstract: The objectives of the research are to study the existing agricultural patterns, and to evaluate the sustainability of agricultural on economic, social and environmental aspects. The samplings were the representatives of the agriculturist group from Ban Paew district, Samut Sakorn province by purposive sampling method of 30 households. The tools being used were interview forms together with the Rapid Rural Appraisal (RRA) and the Participation Rural Appraisal (PRA). The information collected was analyzed with the principle of Content Analysis andusing Descriptive Statistics. After that all the information gotten was analyze the sustainability on the household level and village level. The research result can be concluded as follows: The agricultural Patterns: For most of the cultivation main crop was fruit trees planted and the supplement crop was around the patch or added other plants in the trenches. There were trenches for the cultivating water. The product distribution was by selling (97.5%) and the selling to middle man was the highest number (62.5%). Evaluating the sustainability of the agricultural by the indicators which were appropriate to the area: For the agricultural sustainability on the household level it was found that only one household had sustainable, others household had conditioned sustainable. For on the village level it was found that the sustainability on the issue of agricultural knowledge training had the lowest level (Sustainability index = 31.67%). Secondary was the acknowledging about soil information (Sustainability index = 35.0), and the household labors on agriculture, net return over cash cost (Sustainability index = 55.0%) respectively. Performance percentage is 48.81 %. It was brought to the conclusion that this area did not have the agricultural sustainability.
Abstract: In recent years, the introduction of Pre Engineered Building (PEB) concept in the design of structures has helped in optimizing design. The adoptability of PEB in the place of Conventional Steel Building (CSB) design concept resulted in many advantages, including economy and easier fabrication. In this study, an industrial structure (Ware House) is analyzed and designed according to the Indian standards, IS 800-1984, IS 800-2007 and also by referring MBMA-96 and AISC-89. In this study, a structure with length 187m,width 40m,with clear height 8m and having R-Slope 1:10,isconsidered to carry out analysis& design for 2D frames (End frame, frame without crane and frame with 3 module cranes). The economy of the structure is discussed in terms of its weight comparison, between Indian codes (IS800-1984, IS800-2007) & American code (MBMA-96), & between Indian codes (IS800-1984, IS800-2007).
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.
Abstract: In terms of ecology forecast effects of desertification, the purpose of this study is to develop a predictive model of growth and adaptation of species in arid environment and bioclimatic conditions. The impact of climate change and the desertification phenomena is the result of combined effects in magnitude and frequency of these phenomena. Like the data involved in the phytopathogenic process and bacteria growth in arid soil occur in an uncertain environment because of their complexity, it becomes necessary to have a suitable methodology for the analysis of these variables. The basic principles of fuzzy logic those are perfectly suited to this process. As input variables, we consider the physical parameters, soil type, bacteria nature, and plant species concerned. The result output variable is the adaptability of the species expressed by the growth rate or extinction. As a conclusion, we prevent the possible strategies for adaptation, with or without shifting areas of plantation and nature adequate vegetation.
Abstract: The study aimed to collect morphological data of
secretory structures that contribute to taxonomy of Indigofera. Detail
features of trichomes occurrence in vegetative and reproductive
organs of Indigofera wightii Grah. ex Wigh & Arn., a species
traditionally used as source of indigo to dye “Thaisongdam” clothing
were investigated. Examination through light microscopy and
scanning electrom microscopy were done. Non secretory, T-shaped
trichomes appeared throughout surfaces of stems, leaves, flowers and
fruits. Secretory or glandular trichomes occurred in two types; one
has big cylindrical head and short peduncle, distributed on adaxial
surface of sepals and around the pedicel, whereas another possesses
smaller cylindrical head but long peduncle. The latter was found on
apical surface of immature pods. No phenolic and lipophilic
compounds were detected from these glands.