Protein Quality of Game Meat Hunted in Latvia

Not all proteins have the same nutritional value, since protein quality strongly depends on its amino acid composition and digestibility. The meat of game animals could be a high protein source because of its well-balanced essential amino acids composition. Investigations about biochemical composition of game meat such as wild boar (Sus scrofa scrofa), roe deer (Capreolus capreolus) and beaver (Castor fiber) are not very much. Therefore, the aim of the investigation was evaluate protein composition of game meat hunted in Latvia. The biochemical analysis, evaluation of connective tissue and essential amino acids in meat samples were done, the amino acids score were calculate. Results of analysis showed that protein content 20.88-22.05% of all types of meat samples is not different statistically. The content of connective tissue from 1.3% in roe deer till 1.5% in beaver meat allowed classified game animal as high quality meat. The sum of essential amino acids in game meat samples were determined 7.05–8.26g100g-1. Roe deer meat has highest protein content and lowest content of connective tissues among game meat hunted in Latvia. Concluded that amino acid score for limiting amino acids phenylalanine and tyrosine is high and shows high biological value of game meat.

Biologically Active Caffeic Acid-Derived Biopolymer

The high-molecular water-soluble preparations from several species of two genera (Symphytum and Anchusa) of Boraginaceae family Symphytum asperum, S. caucasicum, S.officinale and Anchusa italica were isolated. According to IR, 13C and 1H NMR, APT, 1D NOE, 2D heteronuclear 1H/13C HSQC and 2D DOSY experiments, the main chemical constituent of these preparations was found to be caffeic acid-derived polyether, namely poly[3-(3,4-dihydroxyphenyl)glyceric acid] (PDPGA) or poly[oxy-1- carboxy-2-(3,4-dihydroxyphenyl)ethylene]. Most carboxylic groups of this caffeic acid-derived polymer of A. italica are methylated.

Effect of Calving Season on the Economic and Production Efficiency of Dairy Production Breeds

The objective of this study was to evaluate the effects of calving season on the production and economic efficiency of dairy farms in Egypt. Our study was performed at dairy production farms in the Alexandria, Behera, and Kafr El-Sheikh provinces of Egypt from summer 2010 to winter 2013. The randomly selected dairy farms had herds consisting of Baladi, Holstein-Friesian, or cross-bred (Baladi × Holstein-Friesian) cows. The data were collected from production records and responses to a structured questionnaire. The average total return differed significantly (P < 0.05) between the different cattle breeds and calving seasons. The average total return was highest for the Holstein- Friesian cows that calved in the winter (29106.42 EGP/cow/year), and it was lowest for Baladi cows that calved in the summer (12489.79 EGP/cow/year). Differences in total returns between the cows that calved in the winter or summer or between the foreign and native breeds, as well as variations in calf prices, might have contributed to the differences in milk yield. The average net profit per cow differed significantly (P < 0.05) between the cattle breeds and calving seasons. The average net profit values for the Baladi cows that calved in the winter or summer were 2413 and 2994.96 EGP/cow/year, respectively, and those for the Holstein- Friesian cows were 10744.17 and 7860.56 EGP/cow/year, respectively, whereas those for the cross-bred cows were 10174.86 and 7571.33 EGP/cow/year, respectively. The variations in net profit might have resulted from variation in the availability or price of feed materials, milk prices, or sales volumes. Our results show that the breed and calving season of dairy cows significantly affected the economic efficiency of dairy farms in Egypt. The cows that calved in the winter produced more milk than those that calved in the summer, which may have been the result of seasonal influences, such as temperature, humidity, management practices, and the type of feed or green fodder available.

Various Advanced Statistical Analyses of Index Values Extracted from Outdoor Agricultural Workers Motion Data

We have been grouping and developing various kinds of practical, promising sensing applied systems concerning agricultural advancement and technical tradition (guidance). These include advanced devices to secure real-time data related to worker motion, and we analyze by methods of various advanced statistics and human dynamics (e.g. primary component analysis, Ward system based cluster analysis, and mapping). What is more, we have been considering worker daily health and safety issues. Targeted fields are mainly common farms, meadows, and gardens. After then, we observed and discussed time-line style, changing data. And, we made some suggestions. The entire plan makes it possible to improve both the aforementioned applied systems and farms.

Influence of Probiotics on Dairy Cows Diet

The main goal of this paper was evaluate the effect of diets containing different levels of probiotic on performance and milk composition of lactating cows. Eight Holstein cows were distributed in two 4x4 Latin square. The diets were based on corn silage, concentrate and the treatment (0, 3, 6 or 9 grams of probiotic/animal/day). It was evaluated the dry matter intake of nutrients, milk yield and composition. The use of probiotics did not affect the nutrient intake (p>0.05) neither the daily milk production or corrected to 4% fat (p>0.05). However, it was observed that there was a significant fall in milk composition with higher levels of probiotics supplementation. These results emphasize the need of further studies with different experimental designs or improve the number of Latin square with longer periods of adaptation.

Heritability and Repeatability Estimates of Some Measurable Traits in Meat Type Chickens Reared for Ten Weeks in Abeokuta, Nigeria

A total of 150 meat type chickens comprising 50 each of Arbor Acre, Marshall and Ross were used for this study which lasted for 10 weeks at the Federal University of Agriculture, Abeokuta, Nigeria. Growth performance data were collected from the third week through week 10 and data obtained were analysed using the Generalized Linear Model Procedure. Heritability estimates (h2) for body dimensions carried out on the chicken strains ranged from low to high. Marshall broiler chicken strain had the highest h2 for body weight 0.46±0.04, followed by Arbor Acre and Ross with h2 being 0.38±0.12 and 0.26±0.06, respectively. The repeatability estimates for body weight in the three broiler strains were high, and it ranged from 0.70 at week 4 to 0.88 at week 10. Relationships between the body weight and linear body measurements in the broiler chicken strains were positive and highly significant (p > 0.05).

The Co-application of Plant Growth Promoting Rhizobacteria and Inoculation with Rhizobium Bacteria on Grain Yield and Its Components of Mungbean (Vigna radiate L.) in Ilam Province, Iran

In order to investigate the effect of Plant Growth Promoting Rhizobacteria (PGPR) and rhizobium bacteria on grain yield and some agronomic traits of mungbean (Vigna radiate L.), an experiment was carried out based on randomized complete block design with three replications in Malekshahi, Ilam province, Iran during 2012-2013 cropping season. Experimental treatments consisted of control treatment, inoculation with rhizobium bacteria, rhizobium bacteria and Azotobacter, rhizobium bacteria and Azospirillum, rhizobium bacteria and Pseudomonas, rhizobium bacteria, Azotobacter and Azospirillum, rhizobium bacteria, Azotobacter and Pseudomonas, rhizobium bacteria, Azospirillum and Pseudomonas and rhizobium bacteria, Azotobacter, Azospirillum and Pseudomonas. The results showed that the effect of PGPR and rhizobium bacteria were significant affect on grain and its components in mungbean plant. Grain yield significantly increased by PGPR and rhizobium bacteria, so that the maximum grain yield was obtained from rhizobium bacteria + Azospirillum + Pseudomonas with the amount of 2287 kg.ha-1 as compared to control treatment. Excessive application of chemical fertilizers causes environmental and economic problems. That is, the overfertilization of P and N leads to pollution due to soil erosion and runoff water, so the use of PGPR and rhizobium bacteria can be justified due to reduce input costs, increase in grain yield and environmental friendly.

Effects of Varying Air Temperature in the Polishing Component of Single-Pass Mill on the Quality of Rice

The effects of varying air temperature (full, ¾ full, ½ full aircon adjustment, no aircon) in polishing component of Single-Pass Mill on the quality of Philippine inbred rice variety, was investigated. Parameters measured were milling recovery (MR), headrice recovery (HR), and percentage with bran streaks. Cooling method (with aircon) increased MR, HR, and percentage with bran streaks of milled rice. Highest MR and HR (67.62%; 47.33%) were obtained from ¾ full adjustment whereas no aircon were lowest (66.27%; 39.76%). Temperature in polishing component at ¾ full adjustment was 33oC whereas no aircon was 45oC. There was increase of 1.35% in MR and 7.57% in HR. Additional cost of milling per kg due to aircon cooling was P0.04 at 300 tons/yr volume, with 0.15 yr payback period. Net income was estimated at ₱98,100.00. Percentage of kernels with bran streaks increased from 5%–14%, indicating more nutrients of milled rice.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Serological IgG Testing to Diagnose Alimentary Induced Diseases and Monitoring Efficacy of an Individual Defined Diet in Dogs

Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.

Protective Effect of Hesperidin against Cyclophosphamide Hepatotoxicity in Rats

The protective effect of hesperidin was investigated in rats exposed to liver injury induced by a single intraperitoneal injection of cyclophosphamide (CYP) at a dose of 150 mg kg-1. Hesperidin treatment (100 mg kg-1/day, orally) was applied for seven days, starting five days before CYP administration. Hesperidin significantly decreased the CYP-induced elevations of serum alanine aminotransferase, and hepatic malondialdehyde and myeloperoxidase activity, significantly prevented the depletion of hepatic glutathione peroxidase activity resulted from CYP administration. Also, hesperidin ameliorated the CYP-induced liver tissue injury observed by histopathological examination. In addition, hesperidin decreased the CYP-induced expression of inducible nitric oxide synthase, tumor necrosis factor-α, cyclooxygenase-2, Fas ligand, and caspase-9 in liver tissue. It was concluded that hesperidin may represent a potential candidate to protect against CYP-induced hepatotoxicity.

The Effect of Electric Field Distributions on Grains and Insect for Dielectric Heating Applications

This paper presents the effect of electric field distribution which is an electric field intensity analysis. Consideration of the dielectric heating of grains and insects, the rice and rice weevils are utilized for dielectric heating analysis. Furthermore, this analysis compares the effect of electric field distribution in rice and rice weevil. In this simulation, two copper plates are used to generate the electric field for dielectric heating system and put the rice materials between the copper plates. The simulation is classified in two cases, which are case I one rice weevil is placed in the rice and case II two rice weevils are placed at different position in the rice. Moreover, the probes are located in various different positions on plate. The power feeding on this plate is optimized by using CST EM studio program of 1000 watt electrical power at 39 MHz resonance frequency. The results of two cases are indicated that the most electric field distribution and intensity are occurred on the rice and rice weevils at the near point of the probes. Moreover, the heat is directed to the rice weevils more than the rice. When the temperature of rice and rice weevils are calculated and compared, the rice weevils has the temperature more than rice is about 41.62 Celsius degrees. These results can be applied for the dielectric heating applications to eliminate insect.

Evaluating the Sustainability of Agricultural by Indicator that Appropriate to the Area of Ban Phaeo District, Samut Sakorn Province, Thailand

The objectives of the research are to study the existing agricultural patterns, and to evaluate the sustainability of agricultural on economic, social and environmental aspects. The samplings were the representatives of the agriculturist group from Ban Paew district, Samut Sakorn province by purposive sampling method of 30 households. The tools being used were interview forms together with the Rapid Rural Appraisal (RRA) and the Participation Rural Appraisal (PRA). The information collected was analyzed with the principle of Content Analysis andusing Descriptive Statistics. After that all the information gotten was analyze the sustainability on the household level and village level. The research result can be concluded as follows: The agricultural Patterns: For most of the cultivation main crop was fruit trees planted and the supplement crop was around the patch or added other plants in the trenches. There were trenches for the cultivating water. The product distribution was by selling (97.5%) and the selling to middle man was the highest number (62.5%). Evaluating the sustainability of the agricultural by the indicators which were appropriate to the area: For the agricultural sustainability on the household level it was found that only one household had sustainable, others household had conditioned sustainable. For on the village level it was found that the sustainability on the issue of agricultural knowledge training had the lowest level (Sustainability index = 31.67%). Secondary was the acknowledging about soil information (Sustainability index = 35.0), and the household labors on agriculture, net return over cash cost (Sustainability index = 55.0%) respectively. Performance percentage is 48.81 %. It was brought to the conclusion that this area did not have the agricultural sustainability.

Phytopathology Prediction in Dry Soil Using Artificial Neural Networks Modeling

The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.

Phytoadaptation in Desert Soil Prediction Using Fuzzy Logic Modeling

In terms of ecology forecast effects of desertification, the purpose of this study is to develop a predictive model of growth and adaptation of species in arid environment and bioclimatic conditions. The impact of climate change and the desertification phenomena is the result of combined effects in magnitude and frequency of these phenomena. Like the data involved in the phytopathogenic process and bacteria growth in arid soil occur in an uncertain environment because of their complexity, it becomes necessary to have a suitable methodology for the analysis of these variables. The basic principles of fuzzy logic those are perfectly suited to this process. As input variables, we consider the physical parameters, soil type, bacteria nature, and plant species concerned. The result output variable is the adaptability of the species expressed by the growth rate or extinction. As a conclusion, we prevent the possible strategies for adaptation, with or without shifting areas of plantation and nature adequate vegetation.

Effects of Maternal Nutrition at Different Stages of Pregnancy in Bali Cows on Growth Performance of the Offspring to Weaning

The objective of this study was to investigate the lifelong effect of in utero nutrition fed at different stages of pregnancy in Bali cows (n = 40): (U1) without in utero nutrition (0 – parturition, negative control); (U2) 0 – 90 d of gestation; (U3) 90 - 180 d of gestation; (U4) 180 d – parturition; and (U5) in utero nutrition along gestation period (0 d to parturition – positive control) on the growth performance of the offspring to weaning age. The results indicated that effect of maternal nutrition on male and female offspring were particularly indicated by the growth performance of both the male and female offspring from birth to weaning.

Morphological Study of Trichomes in Indigofera wightii Grah. ex Wigh & Arn., Indigo Dye Species, Traditionally Used by “Thaisongdam” Thailand

The study aimed to collect morphological data of secretory structures that contribute to taxonomy of Indigofera. Detail features of trichomes occurrence in vegetative and reproductive organs of Indigofera wightii Grah. ex Wigh & Arn., a species traditionally used as source of indigo to dye “Thaisongdam” clothing were investigated. Examination through light microscopy and scanning electrom microscopy were done. Non secretory, T-shaped trichomes appeared throughout surfaces of stems, leaves, flowers and fruits. Secretory or glandular trichomes occurred in two types; one has big cylindrical head and short peduncle, distributed on adaxial surface of sepals and around the pedicel, whereas another possesses smaller cylindrical head but long peduncle. The latter was found on apical surface of immature pods. No phenolic and lipophilic compounds were detected from these glands.

An Effect of Organic Supplements on Stimulating Growth of Dendrobium Protocorms and Seedlings

This study was aimed to investigate the effect of various organic supplements on growth and development of Dendrobium discolor’s protocorms and seedlings growth of Dendrobium Judy Rutz. Protocorms of Dendrobium discolor with 2.0 cm. in diameter and seedlings of Dendrobium Judy Rutz at the same size (0.5 cm. height) were sub-cultured on Hyponex medium supplemented with cow milk (CM), soy milk (SM), potato extract (PE) and peptone (P) for 2 months. The protocorms were developed to seedlings in all treatments after cultured for 2 months. However, the best results were found on Hyponex medium supplemented with P was the best in which the maximum fresh and dry weight and maximum shoot height were obtained in this treatment statistically different (p ≤ 0.05) to other treatments. Moreover, Hyponex medium supplemented with P also stimulated the maximum mean number of 5.7 shoots per explant which also showed statistically different (p ≤ 0.05) when compared to other treatments. The results of growth of Dendrobium Judy Rutz seedlings indicated the medium supplemented with 100 mL/L PE enhanced the maximum fresh and dry weigh per explants with significantly different (p ≤ 0.05) in fresh weight from other treatments including the control medium without any organic supplementation. However, the dry weight was not significantly different (p ≤ 0.05) from medium supplemented with SM and P. There was multiple shoots induction in all media with or without organic supplementation ranging from 2.6 to 3 shoots per explants. The maximum shoot height was also obtained in the seedlings cultured on medium supplemented with PE while the longest root length was found in medium supplemented with SM.

An Effect of Organic Supplements on Stimulating Growth of Vanda and Mokara Seedlings in Tissue Culture

This study aimed to investigate effect of different organic supplements on growth of Vanda and Mokara seedlings. Vanda and Mokara seedlings approximately 0.2 and 0.3 cm. in height were sub-cultured onto VW supplemented with 150 ml/L coconut water, 100 g/L potato extract, 100 g/L ‘Gros Michel’ banana (AAA group) and 100 g/L ‘Namwa’ banana (ABB group). The explants were sub-cultured onto the same medium every month for 3 months. The best medium increased stem height to 0.52 and 0.44 Cm. in Vanda and Mokara respectively was supplemented with coconut water. The maximum fresh weight of Vanda (0.59 g) was found on medium supplemented with ‘Gros Michel’ banana while Mokara cultured on medium supplemented with Potato extract had the maximum fresh weight (0.27 g) and number of roots (5.20 roots/shoot) statistically different (p≤ 0.05) to other treatments. However, Vanda cultured on medium supplemented with ‘Namwa’ banana had the maximum number of roots (3.80 roots/shoot). Our results suggested that growth of different orchid genera was responded diversely to different organic supplements.   

Ethnobotanical Survey of Vegetable Plants Traditionally Used in Kalasin Thailand

Use of plants grown in local area for edible has a long tradition in different culture. The indigenous knowledge such as usage of plants as vegetables by local people is risk to disappear when no records are done. In order to conserve and transfer this valuable heritage to the new generation, ethnobotanical study should be investigated and documented. The survey of vegetable plants traditionally used was carried out in the year 2012. Information was accumulated via questionnaires and oral interviewing from 100 people living in 36 villages of 9 districts in Amphoe Huai Mek, Kalasin, Thailand. Local plant names, utilized parts and preparation methods of the plants were recorded. Each mentioned plant species were collected and voucher specimens were prepared. A total of 55 vegetable plant species belonging to 34 families and 54 genera were identified. The plant habits were tree, shrub, herb, climber, and shrubby fern at 21.82%, 18.18%, 38.18%, 20.00% and 1.82% respectively. The most encountered vegetable plant families were Leguminosae (20%), Cucurbitaceae (7.27%), Apiaceae (5.45%), whereas families with 3.64% uses were Araceae, Bignoniaceae, Lamiaceae, Passifloraceae, Piperaceae and Solanaceae. The most common consumptions were fresh or brief boiled young shoot or young leaf as side dishes of ‘jaeo, laab, namprik, pon’ or curries. Most locally known vegetables included 45% of the studied plants which grow along road side, backyard garden, hedgerow, open forest and rice field.