Abstract: Graves’ Disease (GD), an autoimmune health condition caused by the over reactiveness of the thyroid, affects about 1 in 200 people worldwide. GD is not caused by one specific single nucleotide polymorphism (SNP) or gene mutation, but rather determined by multiple factors, each differing from each other. Malfunction of the genes in Human Leukocyte Antigen (HLA) family tend to play a major role in autoimmune diseases, but other genes, such as LOC101929163, have functions that still remain ambiguous. Currently, little studies were done to study GD, resulting in inconclusive results. This study serves not only to introduce background knowledge about GD, but also to organize and pinpoint the major SNPs and genes that are potentially related to the occurrence of GD in humans. Collected from multiple sources from genome-wide association studies (GWAS) Central, the potential SNPs related to the causes of GD are included in this study. This study has located the genes that are related to those SNPs and closely examines a selected sample. Using the data from this study, scientists will then be able to focus on the most expressed genes in GD patients and develop a treatment for GD.
Abstract: Some Metapenaeus monoceros cox1 gene fragments were isolated, purified, sequenced, and comparatively analyzed with some other Crustacean Cox1 gene sequences (obtained from National Center for Biotechnology Information). This work was designed for testing the efficiency of this system in reconstruction of phylogenetic relations among some Crustacean species belonging to four genera (Metapenaeus, Artemia, Daphnia and Calanus). The single nucleotide polymorphism and haplotype diversity were calculated for all estimated mt-DNA fragments. The genetic distance values were 0.292, 0.015, 0.151, and 0.09 within Metapenaeus species, Calanus species, Artemia species, and Daphnia species, respectively. The reconstructed phylogenetic tree is clustered into some unique clades. Cytochrome oxidase subunit 1 gene (cox1) was a powerful system in reconstruction of phylogenetic relations among evaluated crustacean species.
Abstract: Meat Tenderness is one of the most important factors affecting consumers' assessment of meat quality. Variation in meat tenderness is genetically controlled and varies among breeds, and it is also influenced by environmental factors that can affect its creation during rigor mortis and postmortem. The final postmortem meat tenderization relies on the extent of proteolysis of myofibrillar proteins caused by the endogenous activity of the proteolytic calpain system. This calpain system includes different calcium-dependent cysteine proteases, and an inhibitor, calpastatin. It is widely accepted that in farm animals including chickens, the μ-calpain gene (CAPN1) is a physiological candidate gene for meat tenderness. This study aimed to identify the association of single nucleotide polymorphism (SNP) markers in the CAPN1 gene with the tenderness of chicken breast meat from two Malaysian native and commercial broiler breed crosses. Ten, five months old native chickens and ten, 42 days commercial broilers were collected from the local market and breast muscles were removed two hours after slaughter, packed separately in plastic bags and kept at -20ºC for 24 h. The tenderness phenotype for all chickens’ breast meats was determined by Warner-Bratzler Shear Force (WBSF). Thawing and cooking losses were also measured in the same breast samples before using in WBSF determination. Polymerase chain reaction (PCR) was used to identify the previously reported C7198A and G9950A SNPs in the CAPN1 gene and assess their associations with meat tenderness in the two breeds. The broiler breast meat showed lower shear force values and lower thawing loss rates than the native chickens (p
Abstract: Monoamine oxidase A gene (MAOA) is suggested to
be a candidate gene implicated in many neuropsychiatric disorders,
including autism spectrum disorder (ASD). This meta-analytic review
evaluates the relationship between ASD and MAOA markers such as
30 bp variable number tandem repeats in the promoter region
(uVNTR) and single nucleotide polymorphisms (SNPs) by using
findings from recently published studies. It seems that in Caucasian
males, the risk of developing ASD increase with the presence of 4-
repeat allele in the promoter region of MAOA gene whereas no
differences were found between autistic patients and controls in
Egyptian, West Bengal and Korean population. Some studies point to
the importance of specific haplotype groups of SNPs and interaction
of MAOA with others genes (e. g. FOXP2 or SRY). The results of
existing studies are insufficient and further research is needed.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: A major goal in animal genetics is to understand the role of common genetic variants in diseases susceptibility and production traits. Sahiwal cattle can be considered as a global animal genetic resource due to its relatively high milk producing ability, resistance against tropical diseases and heat tolerant. CYP11B1 gene provides instructions for making a mitochondrial enzyme called steroid 11-beta-hydroxylase. It catalyzes the 11deoxy-cortisol to cortisol and 11deoxycorticosterone to corticosterone in cattle. The bovine CYP11B1 gene is positioned on BTA14q12 comprises of eight introns and nine exons and protein is associated with mitochondrial epithelium. The present study was aimed to identify the single-nucleotide polymorphisms in CYP11B1 gene in Sahiwal cattle breed of Pakistan. Four polymorphic sites were identified in exon one of CYP11B1 gene through sequencing approach. Significant finding was the incidence of the C→T polymorphism in 5'-UTR, causing amino acid substitution from alanine to valine (A30V) in Sahiwal cattle breed. That Ala/Val polymorphism may serve as a powerful genetic tool for the development of DNA markers that can be used for the particular traits for different local cattle breeds.
Abstract: Single nucleotide polymorphisms (SNPs) hold much promise as a basis for disease-gene association. However, research is limited by the cost of genotyping the tremendous number of SNPs. Therefore, it is important to identify a small subset of informative SNPs, the so-called tag SNPs. This subset consists of selected SNPs of the genotypes, and accurately represents the rest of the SNPs. Furthermore, an effective evaluation method is needed to evaluate prediction accuracy of a set of tag SNPs. In this paper, a genetic algorithm (GA) is applied to tag SNP problems, and the K-nearest neighbor (K-NN) serves as a prediction method of tag SNP selection. The experimental data used was taken from the HapMap project; it consists of genotype data rather than haplotype data. The proposed method consistently identified tag SNPs with considerably better prediction accuracy than methods from the literature. At the same time, the number of tag SNPs identified was smaller than the number of tag SNPs in the other methods. The run time of the proposed method was much shorter than the run time of the SVM/STSA method when the same accuracy was reached.