Abstract: Food contamination occurs during post process
handling. This leads to spoilage and growth of pathogenic
microorganisms in the food, thereby reducing its shelf life or
spreading of food borne diseases. Several methods are tried and one
of which is use of antimicrobial packaging. Here, papain, a protease
enzyme, is covalently immobilized with the help of glutarldehyde on
polyurethane and used as a food wrap to protect food from microbial
contamination. Covalent immobilization of papain was achieved at a
pH of 7.4; temperature of 4°C; glutaraldehyde concentration of 0.5%;
incubation time of 24h; and 50mg of papain. The formation of -C=Nobserved
in the Fourier transform infrared spectrum confirmed the
immobilization of the enzyme on the polymer. Immobilized enzyme
retained higher activity than the native free enzyme. The modified
polyurethane showed better reduction of Staphylococcus aureus
biofilm than bare polymer film (eight folds reduction in live colonies,
two times reduction in protein and 6 times reduction in
carbohydrates). The efficacy of this was studied by wrapping it over
S. aureus contaminated cottage cheese (paneer) and cheese and
stored at a temperature of 4°C for 7days. The modified film reduced
the bacterial contamination by eight folds when compared to the bare
film. FTIR also indicated reduction in lipids, sugars and proteins in
the biofilm.
Abstract: Curcuma longa L. (Zingiberaceae), commonly known
as turmeric, has a long history of traditional uses for culinary
purposes as a spice and a food colorant. The present study aimed to
document the ethnobotanical knowledge about Curcuma longa, and
to assess the variation in the herbalists’ experience in Northeastern
Algeria. Data were collected using semi-structured questionnaires
and direct interviews with 30 herbalists. Ethnobotanical indices,
including the fidelity level (FL%), the relative frequency citation
(RFC), and use value (UV) were determined by quantitative methods.
Diversity in the level of knowledge was analyzed using univariate,
non-parametric, and multivariate statistical methods. Three main
categories of uses were recorded for C. longa: for food, for medicine,
and for cosmetic purposes. As a medicine, turmeric was used for the
treatment of gastrointestinal, dermatological, and hepatic diseases.
Medicinal and food uses were correlated with both forms of
preparation (rhizome and powder). The age group did not influence
the use. Multivariate analyses showed a significant variation in
traditional knowledge, associated with the use value, origin, quality,
and efficacy of the drug. The findings suggested that the geographical
origin of C. longa affected the use in Algeria.
Abstract: The study was conducted to evaluate the efficiency of
Garlic and Chili combination solution on control of insect pests in
cabbage crop. The solution was sprayed at different intervals after
transplanting. The efficiency of Garlic and chili combination solution
on cabbage insect pests was measured. Results revealed that Garlic
and chili combination solution was the effectively reduced cabbage
insect pests. On other hand, the spray solution not only reduced the
number of days required for the cabbage growth but also greatly
enhanced the leaf number, head diameter, head weight, and quality of
cabbage. Garlic and chili combination solution have positive effects
on pests reduction and improve growth, yield and quality of cabbage
vegetable.
Abstract: Currently, biological control programs in greenhouse
crops involve the use, at the same time, several natural enemies
during the crop cycle. Also, large number of plant species grown in
greenhouses, among them, the used cultivars are also wide. However,
the cultivar effects on entomophagous species efficacy (predators and
parasitoids) have been scarcely studied. A new method had been
developed, using the factitious prey or host Ephestia kuehniella. It
allow us to evaluate, under greenhouse or controlled conditions
(semi-field), the cultivar effects on the entomophagous species
effectiveness. The work was carried out in greenhouse tomato crop. It
has been found the biological and ecological activities of predatory
species (Nesidiocoris tenuis) and egg-parasitoid (Trichogramma
achaeae) can be well represented with the use of the factitious prey
or host; being better in the former than the latter. The data found in
the trial are shown and discussed. The developed method could be
applied to evaluate new plant materials before making available to
farmers as commercial varieties, at low costs and easy use.
Abstract: The Ballast Water Convention requires less than 5% of the world tonnage for ratification. Consequently, ships will have to comply with the requirements. Compliance evaluation and enforcement will become mandatory. Ship owners have to invest in treatment systems and shipboard personnel have to operate them and ensure compliance. The monitoring and enforcement will be the responsibilities of the Administrations. Herein, a review of the current status of the Ballast Water Management and the issues faced by these are projected. Issues range from efficacy and economics of the treatment systems to sampling and testing. Health issues of chemical systems, paucity of data for decision support etc., are other issues. It is emphasized that management of ballast water must be extended to ashore and sustainable solutions must be researched upon. An exemplar treatment system based on ship’s waste heat is also suggested.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: Non-synchronous breakage or line failure in power
systems with light or no loads can lead to core saturation in
transformers or potential transformers. This can cause component and
capacitance matching resulting in the formation of resonant circuits,
which trigger ferroresonance. This study employed a wavelet
transform for the detection of ferroresonance. Simulation results
demonstrate the efficacy of the proposed method.
Abstract: Plant preparations from thyme and garlic have been shown to be effective acaricides against the poultry red mite, Dermanyssus gallinae. In a layer house with a history of D. gallinae problem, mites were detected in the monitoring traps for the first time and number of them was counted. Then, some rows of layer house was sprayed twice using a concentration of 0.21 mg/cm2 thyme essential oil and 0.07 mg/cm2 garlic juice and a similar row was used as an untreated control group. Red mite traps made of cardboard were used to assess the mite density during days 1 and 7 after treatment and always removed after 24 h. the collected mites were counted and the efficacy against all mite stages (larvae, nymphs and adults) was calculated. Results showed that on day 1 and 7 after the administration of garlic extract efficacy rate was 92.05% and 74.62%, respectively. Moreover, efficacy rate on day 1 and 7 was 89.4% and 95.37% when treatment was done with thyme essential oil. It is concluded that using garlic juice to control of D. gallinae is more effective on short time. But thyme essential oil has a long time effect in compare to garlic preparation.
Abstract: Malaria constitutes one of the major health problems
in Nigeria. One of the reasons attributed for the upsurge was the
development of resistance of Plasmodium falciparum and the
emergence of multi-resistant strains of the parasite to anti-malaria
drugs. A continued search for other effective, safe and cheap plantbased
anti-malaria agents thus becomes imperative in the face of
these difficulties. The objective of this study is therefore to evaluate
the in vivo anti-malarial efficacy of ethanolic extracts of
Chromolaena odorata and Androgaphis paniculata leaves. The two
plants were evaluated for their anti-malaria efficacy in vivo in a 4-day
curative test assay against Plasmodium berghei strain in mice. The
group treated with 500mg/ml dose of ethanolic extract of A.
paniculata plant showed parasite suppression with increase in Packed
Cell Volume (PCV) value except day 3 which showed a slight
decrease in PCV value. During the 4-day curative test, an increase in
the PCV values, weight measurement and zero count of Plasmodium
berghei parasite values was recorded after day 3 of drug
administration. These results obtained in group treated with A.
paniculata extract showed anti-malarial efficacy with higher
mortality rate in parasitaemia count when compared with
Chromolaena odorata group. These results justify the use of
ethanolic extracts of A. paniculata plant as medicinal herb used in
folklore medicine in the treatment of malaria.
Abstract: Occupational Self Efficacy (OSE) reflects the
conviction of a person’s ability to fulfill his job related behavior at a
perfectly acceptable level to the employer. Transformational
leadership improves followers’ commitment by influencing their
needs, values, and self-esteem. Employees also develop a dyadic
relationship with their immediate superiors. Study was conducted
amongst one hundred and twenty two (122) bank managers in Sri
Lanka. They were selected based on multi-stage (seniority in the
hierarchy, gender, department-wise etc.) stratified random sampling.
Major objectives of this study were to analyze the impact of
Transformational leadership style, and OSE along with Sociodemographic
factors, and Career, Job and Organizational experience,
to the Career satisfaction of managers. SPSS software was used for
parametric and non-parametric statistical analyses. Career satisfaction
had positive impacts with their Transformational leadership style, and
their relationships with the immediate superior. Impact of sociodemographic
factors, and career exposure to career satisfaction was
assessed.
Abstract: Gold nanoparticles (AuNPs) have gained increasing
interest in recent times. This is greatly due to their special features,
which include unusual optical and electronic properties, high stability
and biological compatibility, controllable morphology and size
dispersion, and easy surface functionalization. In typical synthesis,
AuNPs were produced by reduction of gold salt AuCl4 in an
appropriate solvent. A stabilizing agent was added to prevent the
particles from aggregating. The antibacterial activity of different
sizes of gold nanoparticles was investigated against Staphylococcus
aureus, Salmonella typhi and Pseudomonas pneumonia using the disk
diffusion method in a Müeller–Hinton Agar. The Au-NPs were
effective against all bacteria tested. That the Au-NPs were
successfully synthesized in suspension and were used to study the
antibacterial activity of the two medicinal plants against some
bacterial pathogens suggests that Au-NPs can be employed as an
effective bacteria inhibitor and may be an effective tool in medical
field. The study clearly showed that the Au-NPs exhibiting inhibition
towards the tested pathogenic bacteria in vitro could have the same
effects in vivo and thus may be useful in the medical field if well
researched into.
Abstract: Fully reusable spaceplanes do not exist as yet. This implies that design-qualification for optimized highly-integrated forebody-inlet configuration of booster-stage vehicle cannot be based on archival data of other spaceplanes. Therefore, this paper proposes a novel TIPSO-SVM expert system methodology. A non-trivial problem related to optimization and classification of hypersonic forebody-inlet configuration in conjunction with mass-model of the two-stage-to-orbit (TSTO) vehicle is solved. The hybrid-heuristic machine learning methodology is based on two-step improved particle swarm optimizer (TIPSO) algorithm and two-step support vector machine (SVM) data classification method. The efficacy of method is tested by first evolving an optimal configuration for hypersonic compression system using TIPSO algorithm; thereafter, classifying the results using two-step SVM method. In the first step extensive but non-classified mass-model training data for multiple optimized configurations is segregated and pre-classified for learning of SVM algorithm. In second step the TIPSO optimized mass-model data is classified using the SVM classification. Results showed remarkable improvement in configuration and mass-model along with sizing parameters.
Abstract: Across the world, initiatives have been introduced to encourage women to enter into and remain in engineering fields. However, research has shown that many women leave engineering or suffer a loss of self-esteem and self-confidence compared to their male counterparts. To address this problem, a South African comprehensive university developed a self-leadership intervention pilot study in 2013, aimed at improving the self-efficacy of its female engineering students and increasing retention rates. This paper is a qualitative, descriptive, and interpretive study of the rationale and operational aspects of the Women in Engineering Leadership Association’s (WELA) self-leadership workshop. The objectives of this paper are to provide a framework for the design of a self-leadership workshop and to provide insight into the process of developing such a workshop specifically for women engineering students at a South African university. Finally, the paper proposes an evaluation process for the pilot workshop, which also provides a framework to improve future workshops. It is anticipated that the self-leadership development framework will be applicable to other higher education institutions wishing to improve women engineering student’s feelings of self-efficacy and therefore retention rates of women in engineering.
Abstract: The efficiency of heavy metals removal from sewage
sludge in bioleaching processes with heterotrophic, chemoautotrophic
(sulphur-oxidizing) sludge cenoses and chemical leaching (in
distilled water, weakly acidic or alkaline medium) was compared.
The efficacy of heavy metals removal from sewage sludge varies
from 83 % (Zn) up to 14 % (Cr) and follows the order: Zn > Mn > Cu
> Ni > Co > Pb > Cr. The advantages of metals bioleaching process
at heterotrophic metabolism were shown. A new process for
bioconversation of sewage sludge into fertilizer at middle
temperatures after partial heavy metals removal was developed. This
process is based on enhancing vital ability of heterotrophic
microorganisms by adding easily metabolized nutrients and synthesis
of metabolites by growing sludge cenoses. These metabolites possess
the properties of heavy metals extractants and flocculants which
provide the enhancement of sludge flocks sedimentation. The process
results in biomineral fertilizer of prolonged action with immobilized
sludge bioelements. The fertilizer satisfies the EU limits for the
sewage sludge of agricultural utilization. High efficiency of the
biomineral fertilizer obtained has been demonstrated in vegetation
experiments.
Abstract: Distributed Generation (DG) systems are considered an integral part in future distribution system planning. Appropriate size and location of distributed generation plays a significant role in minimizing power losses in distribution systems. Among the benefits of distributed generation is the reduction in active power losses, which can improve the system performance, reliability and power quality. In this paper, Artificial Bee Colony (ABC) algorithm is proposed to determine the optimal DG-unit size and location by loss sensitivity index in order to minimize the real power loss, total harmonic distortion (THD) and voltage sag index improvement. Simulation study is conducted on 69-bus radial test system to verify the efficacy of the proposed method.
Abstract: Floating tablets of Marichyadi Vati were developed with an aim to prolong its gastric residence time and increase the bioavailability of drug. Rapid gastrointestinal transit could result in incomplete drug release from the drug delivery system above the absorption zone leading to diminished efficacy of the administered dose. The tablets were prepared by wet granulation technique, using HPMC E50 LV act as Matrixing agent, Carbopol as floating enhancer, microcrystalline cellulose as binder, Sodium bi carbonate as effervescent agent with other excipients. The simplex lattice design was used for selection of variables for tablets formulation. Formulation was optimized on the basis of floating time and in vitro drug release. The results showed that the floating lag time for optimized formulation was found to be 61 second with about 97.32 % of total drug release within 3 hours. The vitro release profiles of drug from the formulation could be best expressed zero order with highest linearity r2 = 0.9943. It was concluded that the gastroretentive drug delivery system can be developed for Marichyadi Vati containing Piperine to increase the residence time of the drug in the stomach and thereby increasing bioavailability.
Abstract: Novel solid lipid nanoparticles (SLNs) were developed to improve oral bioavailability of oxyresveratrol (OXY). The SLNs were prepared by a high speed homogenization technique, at an effective speed and time, using Compritol® 888 ATO (5% w/w) as the solid lipid. The appropriate weight proportions (0.3% w/w) of OXY affected the physicochemical properties of blank SLNs. The effects of surfactant types on the properties of the formulations such as particle size and entrapment efficacy were also investigated. Conclusively, Tween 80 combined with soy lecithin was the most appropriate surfactant to stabilize OXY-loaded SLNs. The mean particle size of the optimized formulation was 134.40 ± 0.57 nm. In vitro drug release study, the selected S2 formulation showed a retarded release profile for OXY with no initial burst release compared to OXY suspension in the simulated gastrointestinal fluids. Therefore, these SLNs could provide a suitable system to develop for the oral OXY delivery.
Abstract: This study was designed for assessment of 3 types of Cysteine protease inhibitors (CPIs) fluromethylketone (FMK), vinyl sulfone (VS) and sodium nitro prussid (SNP), to define which of them is the best for curing S. mansoni infection in mice? In vitro, treated S. mansoni adult worms recorded a mortality rate after 1 hr of exposure to 500 ppm of FMK, VS and SNP as 75, 70 and 60%, respectively. FMK+PZQ treatment recorded the maximum reduction in worm burden (97.2% at 5 wk PI). VS treatment alone or combined with PZQ increases IgM, total IgG, IgG2 and IgG4 levels. In EM study, the completely implanted spines were reported in the degenerated tegument of adult worms in all groups treated with CPIs. VS+PZQ Treatment increased Igs levels but, its effect was different on worm reduction. So, it is not enough to eliminate the infection and FMK+PZQ considered the antischistosomicidal drug of choice.
Abstract: Australia does not have varroa mite. However, we investigated the efficacy of modified hive bottom boards used for varroa mite management in honeybee colonies to control small hive beetle, Aethina tumida. We assessed infestation levels between hives fitted with tube, mesh and conventional (solid) bottom boards in Richmond, NSW eastern Australian. Colonies housed in hives with tube bottom boards were significantly superior to those in hives with conventional and mesh bottom boards. Even though in-hive beetle populations were generally low during the trial period, hives fitted with tube bottom boards however, had fewer small hive beetles than other hives. Although the trial was conducted over only one season, it suggests that there may be benefit in Australian beekeepers changing from using conventional bottom boards even with the absence of varroa mite, when small hive beetle is present.