Abstract: Fluoroquinolones form the mainstay of therapy for the treatment of infections due to Salmonella enterica subsp. enterica. There is a complex interplay between several resistance mechanisms for quinolones and various fluoroquinolones discs, giving varying results, making detection and interpretation of fluoroquinolone resistance difficult. For detection of fluoroquinolone resistance in Salmonella ssp., we compared the use of pefloxacin and nalidixic acid discs as surrogate marker. Using MIC for ciprofloxacin as the gold standard, 43.5% of strains showed MIC as ≥1 μg/ml and were thus resistant to fluoroquinoloes. Based on the performance of nalidixic acid and pefloxacin discs as surrogate marker for ciprofloxacin resistance, both the discs could correctly detect all the resistant phenotypes; however, use of nalidixic acid disc showed false resistance in the majority of the sensitive phenotypes. We have also tested newer antimicrobial agents like cefixime, imipenem, tigecycline and azithromycin against Salmonella spp. Moreover, there was a comeback of susceptibility to older antimicrobials like ampicillin, chloramphenicol, and cotrimoxazole. We can also use cefixime, imipenem, tigecycline and azithromycin in the treatment of multidrug resistant S. typhi due to their high susceptibility.
Abstract: Cortisol is important to our immune system, regulates our stress response, and is a factor in maintaining brain temperature. Saliva cortisol is a practical and useful non-invasive measurement that signifies the presence of the important hormone. Electrical activity in the jaw muscles typically rises when the muscles are moved during yawning and the electrical level is found to be correlated with the cortisol level. In two studies using identical paradigms, a total of 108 healthy subjects were exposed to yawning-provoking stimuli so that their cortisol levels and electrical nerve impulses from their jaw muscles was recorded. Electrical activity is highly correlated with cortisol levels in healthy people. The Hospital Anxiety and Depression Scale, Yawning Susceptibility Scale, General Health Questionnaire, demographic, health details were collected and exclusion criteria applied for voluntary recruitment: chronic fatigue, diabetes, fibromyalgia, heart condition, high blood pressure, hormone replacement therapy, multiple sclerosis, and stroke. Significant differences were found between the saliva cortisol samples for the yawners as compared with the non-yawners between rest and post-stimuli. Significant evidence supports the Thompson Cortisol Hypothesis that suggests rises in cortisol levels are associated with yawning. Ethics approval granted and professional code of conduct, confidentiality, and safety issues are approved therein.
Abstract: Gender-based violence is a reflection of the inequalities that are associated within a society between the men and women that affects the health, dignity, security and autonomy of its victims. There are various determinants that contribute to the health risk of young women who have experienced sexual violence, in countries that have a high prevalence rate for HIV. For instance, in South Africa, where the highest prevalence rate for HIV is among young women, their susceptibility to the virus has been increased by sexual violence and cultural inequalities. Therefore, this study is a review of literature that explores how gender-based violence increases the possibility for HIV/AIDS among young women in South Africa.
Abstract: Concrete as a construction material is versatile because it displays high degree of fire-resistance. Concrete’s inherent ability to combat one of the most devastating disaster that a structure can endure in its lifetime, can be attributed to its constituent materials which make it inert and have relatively poor thermal conductivity. However, concrete structures must be designed for fire effects. Structural components should be able to withstand dead and live loads without undergoing collapse. The properties of high-strength concrete must be weighed against concerns about its fire resistance and susceptibility to spalling at elevated temperatures. In this paper, the causes, effects and some remedy of deterioration in concrete due to fire hazard will be discussed. Some cost effective solutions to produce a fire resistant concrete will be conversed through this paper.
Abstract: The research aims to investigate the occurrence of
multidrug-resistant Acinetobacter, in carrot and estimate the role of
carrot in its transmission in a rapidly growing urban population.
Thus, 50 carrot samples were collected from Jakara wastewater
irrigation farms and are analyzed on MacConkey agar and screened
by Microbact 24E (Oxoid) and susceptibility of isolates is tested
against 10 commonly used antibiotics. Acinetobacter baumannii and
A. lwoffii were isolated in 22.00% and 16% of samples respectively.
Resistance to ceporex and penicillin of 36.36% and 27.27% in A.
baumannii, and sensitivity to ofloxacin, pefloxacin, gentimycin and
co-trimoxazole were observed. However, for A. lwoffii apart from
37.50% resistance to ceporex, it was also resistant to all other drugs
tested. There were similarities in the resistances shown by A.
baumannii and A. lwoffii to fluoroquinolones and β- lactame drug
families in addition to between sulfonamide and animoglycoside
demonstrated by A. lwoffii. Significant correlation in similarities were
observed at P < 0.05 to CPX to NA (46.2%), and SXT to AU (52.6%)
A. baumannii and A. lwoffii respectively and high multi drug
resistance (MDR) of 27.27% and 62.50% by A. baumannii and A.
lwoffii respectively. The occurrence of multidrug-resistance pathogen
in carrot is a serious challenge to public health care, especially in a
rapidly growing urban population where subsistence agriculture
contributes greatly to urban livelihood and source of vegetables.
Abstract: Anogeissus leiocarpus (Combretaceae) is well known
for its medicinal uses in African traditional medicine, for treating
many human diseases mainly skin diseases and infections. Mycetoma
disease is a fungal and/ or bacterial skininfection, mainly cause by
Madurella mycetomatis fungus. This study was carried out in vitro to
investigate the antifungal activity of Anogeissus leiocarpus leaf
extracts against the isolated pathogenic Madurella mycetomatis, by
using the NCCLS modified method compared to Ketoconazole
standard drug, and MTT assay. The bioactive fraction was subjected
to chemical analysis implementing different chromatographic
analytical methods (TLC, HPLC, and LC-MS/MS). The results
showed significance antifungal activity of A. leiocarpus leaf extracts
against the isolated pathogenic M. mycetomatis, compared to negative
and positive controls. The chloroform fraction showed the highest
antifungal activity. The chromatographic analysis of the chloroform
fraction with the highest activity showed the presence of important
bioactive compounds such as ellagic and flavellagic acids derivatives,
flavonoids and stilbenoid, which are well known for their antifungal
activity.
Abstract: The use of magnesium alloys is limited due to their
susceptibility to corrosion although they have many attractive
physical and mechanical properties. To increase mechanical and
corrosion properties of these alloys, many deposition method and
coating types are used. Electroless Ni–B coatings have received
considerable interest recently due to its unique properties such as
cost-effectiveness, thickness uniformity, good wear resistance,
lubricity, good ductility and corrosion resistance, excellent
solderability and electrical properties and antibacterial property. In
this study, electroless Ni-B coating could been deposited on AZ91
magnesium alloy. The obtained coating exhibited a harder and
rougher structure than the substrate.
Abstract: Cortisol is essential to the regulation of the immune
system and pathological yawning is a symptom of multiple sclerosis
(MS). Electromyography activity (EMG) in the jaw muscles typically
rises when the muscles are moved – extended or flexed; and yawning
has been shown to be highly correlated with cortisol levels in healthy
people as shown in the Thompson Cortisol Hypothesis. It is likely
that these elevated cortisol levels are also seen in people with MS.
The possible link between EMG in the jaw muscles and rises in saliva
cortisol levels during yawning were investigated in a randomized
controlled trial of 60 volunteers aged 18-69 years who were exposed
to conditions that were designed to elicit the yawning response.
Saliva samples were collected at the start and after yawning, or at the
end of the presentation of yawning-provoking stimuli, in the absence
of a yawn, and EMG data was additionally collected during rest and
yawning phases. Hospital Anxiety and Depression Scale, Yawning
Susceptibility Scale, General Health Questionnaire, demographic,
and health details were collected and the following exclusion criteria
were adopted: chronic fatigue, diabetes, fibromyalgia, heart
condition, high blood pressure, hormone replacement therapy,
multiple sclerosis, and stroke. Significant differences were found
between the saliva cortisol samples for the yawners, t (23) = -4.263, p
= 0.000, as compared with the non-yawners between rest and poststimuli,
which was non-significant. There were also significant
differences between yawners and non-yawners for the EMG
potentials with the yawners having higher rest and post-yawning
potentials. Significant evidence was found to support the Thompson
Cortisol Hypothesis suggesting that rises in cortisol levels are
associated with the yawning response. Further research is underway
to explore the use of cortisol as a potential diagnostic tool as an assist
to the early diagnosis of symptoms related to neurological disorders.
Bournemouth University Research & Ethics approval granted:
JC28/1/13-KA6/9/13. Professional code of conduct, confidentiality,
and safety issues have been addressed and approved in the Ethics
submission. Trials identification number: ISRCTN61942768.
http://www.controlled-trials.com/isrctn/
Abstract: Urinary Tract Infections are considered as one of the
most common bacterial infections with an estimated annual global
incidence of 150 million. Antimicrobial drug resistance is one of the
major threats due to wide spread usage of uncontrolled antibiotics. In
this study, a total number of 9149 urine samples were collected from
R.H Patiala and processed in the Department of Microbiology G. M.
C Patiala (January 2013 to December 2013). Urine samples were
inoculated on MacConkey’s and blood agar plates and incubated at
370C for 24 hrs. The organisms were identified by colony characters,
Gram’s staining, and biochemical reactions. Antimicrobial
susceptibility of the isolates was determined against various
antimicrobial agents (Hi – Media Mumbai India) by Kirby Bauer
DISK diffusion method on Muller Hinton agar plates. Maximum patients were in the age group of 21-30 yrs followed by
31-40 yrs. Males (34%) are less prone to urinary tract infections than
females (66%). Culture was positive in 25% of the samples.
Escherichia coli was the most common isolate 60.3% followed by
Klebsiella pneumoniae 13.5%, Proteus spp. 9% and Staphylococcus
aureus 7.6%. Most of the urinary isolates were sensitive to,
carbepenems, Aztreonam, Amikacin, and Piperacillin + Tazobactum.
All the isolates showed a good sensitivity towards Nitrofurantoin
(82%). ESBL production was found to be 70.6% in Escherichia coli
and 29.4% in Klebsiella pneumonia. Susceptibility of ESBL
producers to Imipenem, Nitrofurantoin and Amikacin were found to
be 100%, 76%, and 75% respectively. Uropathogens are increasingly
showing resistance to many antibiotics making empiric management
of outpatient UTIs challenging. Ampicillin, Cotrimoxazole and
Ciprofloxacin should not be used in empiric treatment. Nitrofurantoin
could be used in lower urinary tract infection. Knowledge of
uropathogens and their antimicrobial susceptibility pattern in a
geographical region will help in appropriate and judicious antibiotic
usage in a health care setup.
Abstract: Drought is one of the most serious problems posing a
grave threat to cereals production including maize. Maize
improvement in drought-stress tolerance poses a great challenge as
the global need for food and bio-energy increases. Thus, the current
study was planned to explore the variations and determine the
performance of target traits of maize hybrids at grain growth stage
under drought conditions during 2014 under Adana, Mediterranean
climate conditions, Turkey. Maize hybrids (Sancia, Indaco,
71May69, Aaccel, Calgary, 70May82, 72May80) were evaluated
under (irrigated and water stress). Results revealed that, grain yield
and yield traits had a negative effects because of water stress
conditions compared with the normal irrigation. As well as, based on
the result under normal irrigation, the maximum biological yield and
harvest index were recorded. According to the differences among
hybrids were found that, significant differences were observed among
hybrids with respect to yield and yield traits under current research. Based on the results, grain weight had more effect on grain yield
than grain number during grain filling growth stage under water
stress conditions. In this concern, according to low drought
susceptibility index (less grain yield losses), the hybrid (Indaco) was
more stable in grain number and grain weight. Consequently, it may
be concluded that this hybrid would be recommended for use in the
future breeding programs for production of drought tolerant hybrids.
Abstract: Elastomeric polymer foam has been used widely in
the automotive industry, especially for isolating unwanted vibrations.
Such material is able to absorb unwanted vibration due to its
combination of elastic and viscous properties. However, the ‘creep
effect’, poor stress distribution and susceptibility to high
temperatures are the main disadvantages of such a system.
In this study, improvements in the performance of elastomeric
foam as a vibration isolator were investigated using the concept of
Foam Filled Fluid (FFFluid). In FFFluid devices, the foam takes the
form of capsule shapes, and is mixed with viscous fluid, while the
mixture is contained in a closed vessel. When the FFFluid isolator is
affected by vibrations, energy is absorbed, due to the elastic strain of
the foam. As the foam is compressed, there is also movement of the
fluid, which contributes to further energy absorption as the fluid
shears. Also, and dependent on the design adopted, the packaging
could also attenuate vibration through energy absorption via friction
and/or elastic strain.
The present study focuses on the advantages of the FFFluid
concept over the dry polymeric foam in the role of vibration isolation.
This comparative study between the performance of dry foam and the
FFFluid was made according to experimental procedures. The paper
concludes by evaluating the performance of the FFFluid isolator in
the suspension system of a light vehicle. One outcome of this
research is that the FFFluid may preferable over elastomer isolators
in certain applications, as it enables a reduction in the effects of high
temperatures and of ‘creep effects’, thereby increasing the reliability
and load distribution. The stiffness coefficient of the system has
increased about 60% by using an FFFluid sample. The technology
represented by the FFFluid is therefore considered by this research
suitable for application in the suspension system of a light vehicle.
Abstract: The effect of partially substitution of magnetic
impurity Fe for Cu to the magnetic and transport properties in
electron-doped superconducting cuprates of
Eu1.85+yCe0.15-yCu1-yFeyO4+α-δ (ECCFO) with y = 0, 0.010, 0.020, and
0.050 has been studied, in order to investigate the mechanism of
magnetic and transport properties of ECCFO in normal-state.
Magnetic properties are investigated by DC magnetic-susceptibility
measurements that carried out at low temperatures down to 2 K using a
standard SQUID magnetometer in a magnetic field of 5 Oe on field
cooling. Transport properties addressed to electron mobility, are
extracted from radius of electron localization calculated from
temperature dependence of resistivity. For y = 0, temperature
dependence of dc magnetic-susceptibility (χ) indicated the change of
magnetic behavior from paramagnetic to diamagnetic below 15 K.
Above 15 K, all samples show paramagnetic behavior with the values
of magnetic moment in every volume unit increased with increasing y.
Electron mobility decreased with increasing y.
Abstract: Cortisol is essential to the regulation of the immune
system and yawning is a pathological symptom of multiple sclerosis
(MS). Electromyography activity (EMG) in the jaw muscles typically
rises when the muscles are moved and with yawning is highly
correlated with cortisol levels in healthy people. Saliva samples from
59 participants were collected at the start and after yawning, or at the
end of the presentation of yawning-provoking stimuli, in the absence
of a yawn, together with EMG data and questionnaire data: Hospital
Anxiety and Depression Scale, Yawning Susceptibility Scale,
General Health Questionnaire, demographic, health details. Exclusion
criteria: chronic fatigue, diabetes, fibromyalgia, heart condition, high
blood pressure, hormone replacement therapy, multiple sclerosis,
stroke. Significant differences were found between the saliva cortisol
samples for the yawners, t (23) = -4.263, p = 0.000, as compared with
the non-yawners between rest and post-stimuli, which was nonsignificant.
Significant evidence was found to support the Thompson
Cortisol Hypothesis suggesting that rises in cortisol levels are
associated with yawning. Further research is exploring the use of
cortisol as an early diagnostic tool for MS. Ethics approval granted
and professional code of conduct, confidentiality, and safety issues
are approved therein.
Abstract: Now in some countries of the world the cellular
market is on the point of saturation, in others - positive dynamics of
development kept on. The reasons for it are also different, but there
are united by their general susceptibility to innovation changes, if
they are really innovative. If to take as an example the cellular market
of Kazakhstan it is defined by the low percent of smart phones at
consumers, the low population density, undercapacity of the 3G
channel, and absence of universal access to the LTE technology that
limits dynamical growth of this branch. These moments are
aggravated by failures of starting commercial projects by private
companies which prevent to be implemented and widely adopted to a
new product among consumers. The object of the research is possible
integration of wireless and program technologies at which
introduction the idea can regenerate in an innovation. The analysis of
existing projects in the market and the possible union of the
technologies through a prism of theoretical bases of innovative
activity shows that efficiency of the company by development and
introduction of innovations is possible only thanks to strict
observance of all terms and conditions of the innovative process
which main term is profit. Despite that fact that on a global scale the
innovativeness issue of companies is very popular, there are no
researches about possibility of innovative breaks in the field of
wireless access to the Internet in the cellular market of Kazakhstan.
Abstract: This paper presents circuit models to analyze the
conducted susceptibility of multiconductor shielded cables in
frequency domains using Branin’s method, which is referred to as the
method of characteristics. These models, which can be used directly
in the time and frequency domains, take into account the presence of
both the transfer impedance and admittance. The conducted
susceptibility is studied by using an injection current on the cable
shield as the source. Two examples are studied; a coaxial shielded
cable and shielded cables with two parallel wires (i.e., twinax cables).
This shield has an asymmetry (one slot on the side). Results obtained
by these models are in good agreement with those obtained by other
methods.
Abstract: The sub-task pattern in terms of deviations and defects
should be identified and understood in order to improve the quality of
practices in construction projects. Therefore, sub-task susceptibility
to exposure to deviations and defects has been evaluated and
classified via six classifications proposed in this study. Thirty-four
case studies of specific sub-tasks (from compression members in
constructed concrete structures) were collected from seven
construction projects in order to examine the study’s proposed
classifications. The study revealed that the sub-task has a high
sensitivity to deviation, where 91% of the cases were recorded as
deviations; however, only 19% of cases were recorded as defects.
Other findings were that the actual work during the execution process
is a high source of deviation for this sub-task (74%), while only 26%
of the source of deviation was due to both design documentation and
the actual work. These findings significantly imply that the study’s
proposed classifications could be used to determine the pattern of
each sub-task and develop proactive actions to overcome issues of
sub-task deviations and defects.
Abstract: Pollution of the Klip River has caused
microorganisms inhabiting it to develop protective survival
mechanisms. This study isolated and characterized the heavy metal
resistant bacteria in the Klip River. Water and sediment samples were
collected from six sites along the course of the river. The pH,
turbidity, salinity, temperature and dissolved oxygen were measured
in-situ. The concentrations of six heavy metals (Cd, Cu, Fe, Ni, Pb
and Zn) of the water samples were determined by atomic absorption
spectroscopy. Biochemical and antibiotic profiles of the isolates were
assessed using the API 20E® and Kirby Bauer Method. Growth
studies were carried out using spectrophotometric methods. The
isolates were identified using 16SrDNA sequencing. The uppermost
part of the Klip River with the lowest pH had the highest levels of
heavy metals. Turbidity, salinity and specific conductivity increased
measurably at Site 4 (Henley on Klip Weir). MIC tests showed that
16 isolates exhibited high iron and lead resistance. Antibiotic
susceptibility tests revealed that the isolates exhibited multitolerances
to drugs such as Tetracycline, Ampicillin, and
Amoxicillin.
Abstract: This study investigates the effect of moisture
conditioning on the Indirect Tensile Strength (ITS) of asphalt
concrete. As a first step, cylindrical samples of 100 mm diameter and
50 mm thick were prepared using a Superpave gyratory compactor.
Next, the samples were conditioned using Moisture Induced
Susceptibility Test (MIST) device at different numbers of moisture
conditioning cycles. In the MIST device, samples are subjected water
pressure through the sample pores cyclically. The MIST conditioned
samples were tested for ITS. Results show that the ITS does not
change significantly with MIST conditioning at the specific pressure
and cycles adopted in this study.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Polymeric materials have become an integral part of every aspect of today's industry. They have wide applications, inter alia, in areas such as medicine, food industry and agriculture. In agriculture, for example, they are used for the production of pots, irrigation systems and for soil mulching. The aim of this study was the attempt to produce a biodecomposable agricultural mat, by coating cotton fabric with a blend of carboxylated styrene-butadiene latex (LBSK) containing the enzymatic hydrolyzate of keratin from cattle hair, which would serve as a material for mulching.
The production of such material allows the beneficial management of burdensome tannery waste constituted by keratin from cattle hair and at the same time, the production of agricultural mats that much faster undergo decomposition than commonly used polyethylene mats.