Abstract: Tbilisi, a large city of the South Caucasus, is a junction point connecting Asia and Europe, Russia and republics of the Asia Minor. Over the last years, its atmosphere has been experienced an increasing anthropogenic load. Numerical modeling method is used for study of Tbilisi atmospheric air pollution. By means of 3D non-linear non-steady numerical model a peculiarity of city atmosphere pollution is investigated during background western light air. Dust concentration spatial and time changes are determined. There are identified the zones of high, average and less pollution, dust accumulation areas, transfer directions etc. By numerical modeling, there is shown that the process of air pollution by the dust proceeds in four stages, and they depend on the intensity of motor traffic, the micro-relief of the city, and the location of city mains. In the interval of time 06:00-09:00 the intensive growth, 09:00-15:00 a constancy or weak decrease, 18:00-21:00 an increase, and from 21:00 to 06:00 a reduction of the dust concentrations take place. The highly polluted areas are located in the vicinity of the city center and at some peripherical territories of the city, where the maximum dust concentration at 9PM is equal to 2 maximum allowable concentrations. The similar investigations conducted in case of various meteorological situations will enable us to compile the map of background urban pollution and to elaborate practical measures for ambient air protection.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Recently, Northeast Asia has become one of the three
largest trade areas, covering approximately 30% of the total trade
volume of the world. However, the distribution facilities are saturated
due to the increase in the transportation volume within the area and
with the European countries. In order to accommodate the increase of
the transportation volume, the transportation networking with the
major countries in Northeast Asia and Europe is absolutely necessary.
The Eurasian Logistics Network will develop into an international
passenger transportation network covering the Northeast Asian region
and an international freight transportation network connecting across
Eurasia Continent. This paper surveys the changes and trend of the
distribution network in the Eurasian Region according to the political,
economic and environmental changes of the region, analyses the
distribution network according to the changes in the transportation
policies of the related countries, and provides the direction of the
development of composite transportation on the basis of the present
conditions of transportation means. The transportation means optimal
for the efficiency of transportation system are suggested to be train
ferries, sea & rail or sea & rail & sea. It is suggested to develop
diversified composite transportation means and routes within the
boundary of international cooperation system.
Abstract: This article discusses the customs and traditions in
Turkestan in the late XIXth and early XXth centuries. Having a long
history, Turkestan is well-known as the birthplace of many nations
and nationalities. The name of Turkestan is also given to it for a
reason - the land of the Turkic peoples who inhabited Central Asia
and united under together. Currently, nations and nationalities of the
Turkestan region formed their own sovereign states, and every year
they prove their country names in the world community. Political,
economic importance of Turkestan, which became the gold wire
between Asia and Europe was always very high. So systematically
various aggressive actions were made by several great powers. As a
result of expansionary policy of colonization of the Russian Empire -
the Turkestan has appeared.